v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1150 (LINC01150) URS000075AE86_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01150: LINC01150 is an immune-associated long non-coding RNA (lncRNA) that may exert protective effects in lung adenocarcinoma (LUAD) [PMC8798323]. A heatmap analysis of immune-associated lncRNAs in LUAD showed that LINC01150, along with AC026355.2 and AL590226.1, may have protective effects [PMC8798323]. In a study investigating the relationship between cuproptosis-related lncRNAs and immune checkpoint genes, LINC01150 was found to have a correlation with HAVCR2 and CD209 [PMC9465020]. Furthermore, LINC01150 was found to be closely related to clinical characteristics and independently predicted survival in LUAD patients [PMC8798323]. A prognostic lncRNA signature was identified using multivariate Cox regression analysis, which included LINC01150 as one of the six TME-related lncRNAs [PMC8739902]. siRNA sequences targeting LINC01150 were designed for experimental purposes [PMC9465020]. Other differentially expressed immune-related lncRNAs, including ITGB1-DT, LINC02345, C2orf27A, AC027117.1, MIR223HG, AC010980.2, MIR223HG, AC027031.2, AC010980.2 and AC012645.3 were identified as potential indicators for further study [PMC8436904]. In a study on hub lncRNAs in LUAD patients' survival prediction models using bioinformatics analysis methods showed that LINC01150 is one of the five protective factors [PMC9434379]. References: - PMC8798323 - PMC9465020 - PMC8739902 - PMC8436904 - PMC9434379

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGGGUUUUCAUAGAUAUCCUGUAUUAGGUUAGGGAAGUUCCCUCUAUUCCUAAUUUACUGAGUGAUGUUUUUUAAACAAAUCAGGAACCGACGUUGGAUUUUUCAAAUGCUUUUUCUGUACUGUUAAAAGAAAAACCUUAGACAAAUUAAAUUUAACAGAGUUUAAUUAAGCAAAGAACCACUCGCUAAUGGGGCAGCCCCCAAACCAAAAUAGGUUCAGAGAGGCUCUGGUGCUGCCGUGUGGCUGAAGAUUGGUGGACAGAAAAGGGAAAGGAGGCACAGAAAACGGAAGCAAAGCACAGAAACCGCCAGAGGGGCUGCAGCUCCAUGCUUGCCUUAUCUGAACACGGUUGGAAUGGCCGGCACCCUUGAUGAGCGGAAACCUGGGUGUUGCUCUGUCACCCAGGCUGGAGUGCAGUGGUGCCAUCAUAGCUCACUGCAAUUGUUACAGGAGAGGGGUCCUGAUCCAGACCCCAAGAGAGGGUUCUUGGAUUUGGAUCCUGUGCAAGAAAGAAUUCAGGUGACUUAGAAUGCCUGACCAUGUGGGAAUGCAGCCCAGUAGGACUCAGUCUCAUUUUACCCAGCCCCUGUUCAAGAUGGAGUCGCUCUGGUUCACACGCCUCAGACACAGCCUCUGCCUCCCGCCUCAGCCUCCUAAGCAGCUGGGACUACAGUGCAUACCUGAUUUUCUCGACCUCUUUUAUGAAAUAUCCCCGCCAGACUCCCUCGACCGUGCCACCCCCAGGUUCCCGUGCAUACACAACAUUGCGGGAUAGGUAUUGUGGAAUGAGGAUCCGUGUUACGACCUACAGAAGAUGUGGCUGUGAAGUCAGGAGUCACGGUCUCAGAGUUGACUGCACUGCCUCGUAGCUGUGUGACCUUCAGGAUUUUGUUCAACCCCCUCUGAGCUUCAGUUUGCUCUCUGGGAAGACUCCAAGGAUAAGAGCAUCUACCUCCUCAGCCUGCUGUGAGAGUUAACAGGGCCAGGGCCAAAGACGCUUUGUCUGACUGCUGGUCUGCGGGGAGCUCUAAAUAUGAAUCUGCUACAUCACCUUCACUUUUGAAUUCGGCUCUGAUGUUCCAAAUGUUCUUGGCCGUUCCUUCGUGUUUCUCCUGUACGAAUUUCAGCUUCUUUUUGCCAAGUAUCUCCCCACCCCCGCCCACCCCCACCCCCAAAUAAACUCACUAGAAUGUUGGCUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications