Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3185 precursor URS000075AE3A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3185: MIR3185 is a specific primate genome miRNA that has been studied in relation to fatigue and mood disturbance [PMC9105576]. In a study involving 30 participants, an inverse correlation was observed between MIR3185 and the gene PGK1, which is a potential biomarker for fatigue [PMC9105576]. Additionally, MIR3185 was found to be correlated with the TMD and FI subscales, which assess mood disturbance [PMC9105576]. The levels of MIR3185 and PGK1 were found to be responsive to changes in mood state and fatigue [PMC9105576]. The study suggests that MIR3185 may regulate the expression of PGK1 in response to changes in fatigue levels [PMC9105576]. Furthermore, luciferase reporter assays were conducted to investigate the effects of MIR3185 on ATG5, ATG7, and Linc02527 genes in HTR8 cells [PMC6155230]. These findings contribute to our understanding of detectable changes in exosomal biomolecular composition and highlight the potential of PGK1 and MIR3185 as biomarkers for mood- and fatigue-associated cognitive impairment [PMC9105576].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAUGGAAGAAGAAGGCGGUCGGUCUGCGGGAGCCAGGCCGCAGAGCCAUCCGCCUUCUGUCCAUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications