Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U4atac small nuclear (RNU4ATAC) secondary structure diagram

Homo sapiens (human) RNA, U4atac small nuclear (RNU4ATAC) URS000075ADBA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU4ATAC: RNU4ATAC is a gene that encodes the small nuclear RNA (snRNA) U4atac, which is a component of the minor spliceosome [PMC4772811]. Mutations in splicing proteins have been linked to primordial dwarfism, and specifically, mutations in RNU4ATAC have been found to cause MOPDI [PMC4045235]. MOPD1 is a form of primordial dwarfism that results from biallelic mutations in the RNU4ATAC gene [PMC4772811]. The minor spliceosome, which includes U4atac, is responsible for splicing specific introns that are not recognized by the major spliceosome [PMC4045235]. Mutations in RNU4ATAC disrupt the normal splicing process and lead to abnormal development and growth [PMC4772811]. The identification of RNU4ATAC mutations as a cause of MOPDI has provided insights into the molecular mechanisms underlying primordial dwarfism and has expanded our understanding of the role of splicing in development [PMC4045235]. Further research is needed to fully elucidate how mutations in RNU4ATAC specifically contribute to the pathogenesis of MOPDI and how they affect splicing processes [PMC4772811].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCAUCCUUUUCUUGGGGUUGCGCUACUGUCCAAUGAGCGCAUAGUGAGGGCAGUACUGCUAACGCCUGAACAACACACCCGCAUCAACUAGAGCUUUUGCUUUAUUUUGGUGCAAUUUUUGGAAAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications