Gallus gallus (chicken) microRNA gga-mir-204 precursor (gga-mir-204-1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-204 precursor (gga-mir-204-1) URS000075AD4A_9031

104 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 5 other species
2 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUCAACAGUGUCUGUUCAUGUGACCCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGGGGCUGGGAAGGCAAAGGGACGUUCAACUGUCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Chrysolophus pictus microRNA 204 (ENSCPIG00010000519.1)
Coturnix japonica (Japanese quail) microRNA 204 (ENSCJPG00005007769.1)
Meleagris gallopavo (turkey) microRNA 204 (ENSMGAG00000021405.1)
Pavo cristatus (Indian peafowl) microRNA 204 (ENSPSTG00000014803.1)
Phasianus colchicus microRNA 204 (ENSPCLG00000013537.1)

2D structure

Publications