Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-382 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-382 precursor URS000075ABA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR382: MIR382 is a candidate miRNA that has been identified as a potential modulator of KIF14 mRNA levels in ovarian cancer (OvCa) tumors [PMC3953446]. It has also been shown to reduce the expression of SLC7A11, promoting ferroptosis [PMC8572460]. Inhibition of MIR382 can increase PTEN levels, leading to the inhibition of the PI3K/AKT/mTOR pathway and a decrease in HIF-1α [PMC4081109]. Increased expression of MIR382 has been found to inhibit HIV-1 replication in macrophages through sequence complementarity and binding to viral mRNA [PMC4406127]. Overexpression of MIR382 can decrease voluntary intake and preference for ethanol [PMC5836055]. Decreased expression of MIR382 has been associated with poor outcomes in osteosarcomas [PMC3953446]. In a study involving BMSCs, silencing HDAC3 resulted in a decrease in exosomal expression of miR380 and MIR382 [PMC6883144]. Increased expression of MIR382 has also been observed in ON-derived cells from individuals with schizophrenia and bipolar disorder, suggesting its potential role in these psychiatric disorders [PMC4354342] [PMC7527411]. MIR382 is an important miRNA that plays diverse roles in various biological processes, including cancer development, viral replication inhibition, alcohol preference modulation, and psychiatric disorders. Further research is needed to fully understand the mechanisms by which MIR382 exerts its effects.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUUGAAGAGAAGUUGUUCGUGGUGGAUUCGCUUUACUUAUGACGAAUCAUUCACGGACAACACUUUUUUCAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002533.1)
  2. Bos taurus microRNA bta-mir-382 precursor
  3. Capra hircus microRNA mir-382 (ENSCHIG00000009476.1)
  4. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022926.2)
  5. Cavia aperea (Brazilian guinea pig) microRNA 382 (ENSCAPG00000003925.1)
  6. Cavia porcellus microRNA 382 (ENSCPOG00000021510.2)
  7. Cebus imitator (Panamanian white-faced capuchin) microRNA 382 (ENSCCAG00000004214.1)
  8. Cercocebus atys miRNA (ENSCATG00000020318.1)
  9. Chinchilla lanigera (Long-tailed chinchilla) microRNA 382 (ENSCLAG00000021287.1)
  10. Choloepus hoffmanni (Hoffmann's two-fingered sloth) microRNA 382 (ENSCHOG00000014542.1)
  11. Colobus angolensis palliatus miRNA (ENSCANG00000003656.1)
  12. Equus caballus (horse) microRNA eca-mir-382 precursor
  13. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000002645.1)
  14. Gorilla gorilla gorilla microRNA 382 (ENSGGOG00000028636.2)
  15. Heterocephalus glaber (naked mole-rat) microRNA 382 (ENSHGLG00000022783.1, ENSHGLG00100024078.1)
  16. Ictidomys tridecemlineatus microRNA 382 (ENSSTOG00000016729.3)
  17. Jaculus jaculus miRNA (ENSJJAG00000007004.1)
  18. Loxodonta africana (African savanna elephant) microRNA 382 (ENSLAFG00000025361.1)
  19. Macaca mulatta microRNA mml-mir-382 precursor
  20. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004617.1)
  21. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000017108.1)
  22. Microcebus murinus (gray mouse lemur) microRNA 382 (ENSMICG00000018085.3)
  23. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 382 (ENSNLEG00000022542.2)
  24. Octodon degus miRNA (ENSODEG00000022406.1)
  25. Pan paniscus (bonobo) microRNA 382 (ENSPPAG00000013248.1)
  26. Panthera pardus microRNA 382 (ENSPPRG00000014039.1)
  27. Panthera tigris altaica microRNA 382 (ENSPTIG00000002526.1)
  28. Pan troglodytes ptr-mir-382 (ENSPTRG00000027589.3)
  29. Pongo abelii miRNA
  30. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019841.1)
  31. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000011593.1)
  32. Pteropus vampyrus (large flying fox) microRNA 382 (ENSPVAG00000026468.1)
  33. Rhinopithecus bieti miRNA (ENSRBIG00000011535.1)
  34. Rhinopithecus roxellana miRNA (ENSRROG00000005719.1)
  35. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000018372.1)
  36. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000023354.1)
2D structure Publications