v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CHRM3 antisense RNA 2 (CHRM3-AS2) URS000075AB95_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CHRM3-AS2: CHRM3-AS2 is an lncRNA that plays a role in regulating gene expression [PMC8962832]. It has been found to up-regulate the expression of KLF4 [PMC8962832]. Additionally, CHRM3-AS2 is one of the five immune-related lncRNAs, along with AC134312.1, AL133467.1, LINC01722, and LINC02207, that form a predictive signature with prognostic significance for ovarian carcinoma patients [PMC8110384]. The subcellular localization of CHRM3-AS2 has been determined using FISH [PMC8962832].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUAACUCAUAGCCCUGUAUUUUGCUAAGUUUUUCCUCUACUCUUGAGUCCUCCUUUAAUCUAUAGAGUGUUAUUCUACACUGGACCUCUCUCUUAUUUUUUGGAGUCUAGCAUCUUGCAUCUUCCUGGAGCCCCAACUAAACUCAUAACUUCUAAGCUUCUAAGAAAUAUAUGACGAGCUCCAUGAGGGCCAAGGCUCUCCAUUCUUGUUCACCACUGCACACUCAGGAGCUCAUGGCAUGCUGGCUGUGCUAGUUCUAUCCUCAACAGAAUAAUUGCUGACAAACUCUCUUGCCCAGAAAAUGUCUACUGGAAUUAUGGAGUACAAAAAAACUACAAAAGCAAUGAAAAAAAGAAGGAUGUUUUAUUUACAUCCUAUUUCAAAACCAUUGCUUUCUUGCUAUUGUAUGUCUCUGCAGGCCCAAUAUCGCGCAUCUUCAUAAGAAGUUUAGAAUUGUUCCUUAUGUUUCCUUCUAACAAACACUGGUAUAUUCACAUGAAAGUGUAUAUUUUAUUCACUUCCAAAACAGUUAGCUCAUAAUUCAGAACAUUGAGGUUUGCAAAAUGACUGAAGGAAACUUUACCUAAACAAUAGUUGCCAGUUCUGCUGAGAAUUAUCACGGGCCCACAACGGCUGUGUGUUUUUCCAUACAGAUAUUCUAAUUUUUUUAUUAUGCAGCUAAUUUUUUUUUAGACUCGCGAAUAAAAUAGCAAGUCAGUCUGUGCAUAAGCAUAUGUUUAAAUCUACCAGGAGAAAUGUCUGGAAUCUUUUUGGUUAUUAAAAUUAAAAUUCAGGAUAAUGAAAGGCAUAUGCAACUUAUUAUAUUCUUUAUAUAACUUAUUUCAUCUAAUCCUCCAAAUAGCUAUAUAACAUAUUUAUCCCCACCUUACAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications