Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small Cajal body-specific RNA 9 (SCARNA9) URS000075AAF7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA9: SCARNA9 is a small Cajal body-specific RNA (scaRNA) that plays a role in RNA processing [1]. It has been shown that coilin processing activity is preferential towards SCARNA9 compared to scaRNA2, and the GU-rich dinucleotide repeat region in SCARNA9 affects coilin processing [1]. CSTF2tau recognizes SCARNA7 and SCARNA9, which guide the modification of RNA polymerase II transcribed spliceosomal RNAs U1 and U2 [2]. Among immune-related long non-coding RNAs (lncRNAs), SCARNA9 is identified as a protective lncRNA [3]. The ratio of the mgU2-30 fragment to full-length SCARNA9 is altered in endogenous SCARNA9 upon treatment with etoposide, as observed for ectopically expressed SCARNA9 [4]. WT SCARNA9 is found to be enriched in Cajal bodies, nucleoli, and nucleoplasm [5]. Northern blotting and detection with labeled probes are used to evaluate RNA from untransfected cells or cells transfected with the SCARNA9 plasmid [4]. The dynamics of full-length SCARNA9 are influenced by Drosha reduction, suggesting an impact on the ratio of full-length SCARNA9 to its processed fragment [4]. Adjusted images are provided for better visualization of endogenous full-length SCARNA9 and the mgU2-30 fragment [4]. References: 1. [PMC4395269] 2. [PMC5449641] 3. [PMC7893582] 4. [PMC6176948] 5. [PMC5612246]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCUGAGAUCUGCUUUUAGUGAAGUGGAUCAAUGAUGAAACUAGCCAAAUCUGAGCAUCAGAAGUCUUUCCAGUCUACCUGAUGCAUGAUCUCUACAGUUCUGAGAAGCAAAACUAUAAAACAAUGUAAAACAAUAAGGGCAUAUGUCUGGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUACGCACAUGUGUUUAUAAAGAUAACAGCUGUAGGAAUGAAUGAGAUUGAGGGUGGGGGGGUGCGUAUGUAUGUCUAUGAAAGCCUAAUCAUUUCUGGGCAAUGAUGAAAAGGUUUUACUACUGAUCUUUGUAACUAUGAUGGUUUCUACACUUGACCUGAGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications