Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXD3 antisense RNA 1 (FOXD3-AS1) URS000075AAAF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FOXD3-AS1: FOXD3-AS1 is a long non-coding RNA (lncRNA) that can be significantly upregulated in lung epithelial cells after hyperoxia [PMC9861694]. It has been investigated in glioma patients, where differences in immune infiltration were observed based on varying levels of FOXD3-AS1 expression [PMC10110859]. In melanoma, FOXD3-AS1 has been identified as an oncogene [PMC8273965]. In nasopharyngeal carcinoma cells, FOXD3-AS1 was found to inhibit cell apoptosis by negatively regulating miR-135a-5p and miR-185-3p and upregulating the level of FOXD3 [PMC8914342]. Additionally, FOXD3-AS1 was shown to contribute to cell migration, invasion, and epithelial-mesenchymal transition (EMT) by elevating ZCCHC3 expression in osteosarcoma cells [PMC7653078]. It was also found that FOXD3-AS1 promotes the enrichment of H3K27ac in the promoter region of YBX1 [PMC8359730]. Mechanistically, FOXD3-AS1 interacts with poly (ADP-ribose) polymerase 1 (PARP1) to prevent poly (ADP)-ribosylation and activation of CTCF, leading to a decrease in downstream tumor-suppressive genes [PMC10008945]. Depletion of FOXD3-AS1 increased apoptosis in glioblastoma cells [PMC8974031], melanoma cells [PMC10110859], and non-small cell lung cancer (NSCLC) patients had poor prognosis with high expression levels of FOXD3 AS 2[PMCID: PMC856162]. Furthermore, it has been suggested that FOXD3 AS 2 could serve as a biomarker for diagnosis, treatment, and prognosis in various diseases [PMC8914342]. Overall, FOXD3-AS1 plays a role in various malignancies and has potential clinical applications [PMC9492367].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGAAUUGUCAACAAAGGGACGAGAGACGCGCAACUCCGCUCCGCACUGUGCGCCAGCAUCCCCGGGGCACGGAGGGCGCUGCGGCCCGCCCGGAGACCCCCCCACCCAGGCUGGAUCCGGGCCCUGGGGCCCAGGGAGCGGCUUUAAAGAGUAAGAGCAGCGCACCCGGCUCCCUCCUGCUAAUUAGAUUUCAGAUUCCCCUCUGGCCUCAGUGCUCAUUCCGGGGAAGACACCUGCUGAGAUGUCUUUUUCCCCCUCCCCCAACCAAACCACUCAGGUCCUACCUGCUCUUUCCCGGCUUGAUGCGGGCGUGUUUUCCUGUAUGUAUUUUUUCGUGCGGCCACAAAAAGCAUCAGCUGGGGUUCCCGAAGGUCAGAAAAUGGCUAUUGAUUAAUCUACUAGAAUAGUUGCCGAGAGAAAUAAAAACGACGUAAAAUAGCAGGGAACCUAUAAAUAAAGAAGCCAUAACUGGCUACUUGGAGUUGUUAAACGACUUAGCAUAUGAAAAAAUCGGAAAUGAGGCGCUGGGGAAGGAGCUGGGAUUGGCAGCGGCCUGGGUGUGGACAAAUCCUCCAAGAUUUAACUUCCAAGAAAACCGGCGGCGGAGCGGGUGGAGGAGGCGAGGAUGUGUGGCCAAUGCACGCGGAGUGCAAGGCCGCCUAGUUGGGAGCCGCAAGAGCCUGCCUGGUGUGGCAGGCACACGGAACCCAAUCCCUGUCUGUCCGCUGCGGCCUGGGAGGGGAGCGCCGGCCUCACCAGAGGAAGGAGCACGAGGGGAGGAGUUCCGAGAGGAAAUAAUUAGUGAAAUAUUUGCAGAAGAUGCUGGGAUGUGGAUUUAAUUCCGGAUGGACAGUGGUGCUUCUGAUUCCCUCAGUCUGUUUCCCCACCCACGAUCUCCUCUUUCCUUGGCCUAGACACACCAAAAAUAAUUCAAUAAAAUAAAAAUAAAAAUUUAAAAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications