Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-376c precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-376c precursor URS000075AAAD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR376C: MIR376C is a microRNA that undergoes rapid turnover, and its abundance and function are highly dependent on the continued transcription and processing of pri-MIR376C [PMC7486624]. The expression of MIR376C leads to an increase in the repression of α1 and γ2 translation, resulting in a reduction in the number of functional synapses at dendritic inhibitory synapses [PMC7486624]. This reduction is manifested by a decrease in the total number of functional synapses [PMC7486624]. The findings suggest that MIR376C plays a crucial role in regulating GABAARs at dendritic inhibitory synapses, potentially impacting synaptic transmission and neuronal excitability [PMC7486624]. Further research is needed to fully understand the mechanisms by which MIR376C influences GABAARs and its implications for neuronal function.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUAUUUAUGGUUAAACAUAGAGGAAAUUCCACGUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Macaca mulatta microRNA mml-mir-376c precursor
  2. Pan troglodytes miRNA
  3. Pongo abelii miRNA
  4. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-376c precursor
2D structure Publications