Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-615_3p (mature (guide)) URS000075AA7E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-615: Hsa-mir-615 is a microRNA that has been transfected into cultured cells using Opti-MEM I Reduced-Serum Medium and X-treme Gene siRNA Transfection Reagent [1][PMC4196923]. It has been identified as one of the abnormally expressed miRNAs in head and neck squamous cell carcinoma (HNSCC) tissues [2][PMC8430304]. Another study recommended using hsa-mir-615 as a diagnostic marker for HNSCC [3][PMC10093007]. The rs7958904 SNP may affect the binding activity of hsa-mir-615 [4][PMC4806879]. Hsa-mir-615 has also been transfected into CMT 93 cells and used in nucleofection experiments [5][PMC8240225]. In terms of prognosis, the expression levels of hsa-mir-383 have shown significant differences, while no significant differences were observed for hsa-mir-615 or hsa-mir-877 [6][PMC6921333]. The combination of hsa-mir-383, hsa-mir-615, and hsa-mir-877 has demonstrated excellent diagnostic value in HNSCC patients [6][PMC6921333]. Methylation of hsa-miR-615 was observed in cervical cancer cells but not in HPV-transformed keratinocytes [7][PMC5190061]. HSA-MIR 615 is also involved in the KEGG pathway MicroRNAs in cancer pathway [8][PMC9998480]. The target prediction for HSA-MIR 615 was run using the PITA prediction algorithm on human cDNAs downloaded from Ensembl BioMart [9][PMC4597612].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGAGCCUGGGUCUCCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Publications