v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TSPEAR antisense RNA 2 (TSPEAR-AS2) URS000075A9E0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TSPEAR-AS2: TSPEAR-AS2 is a long non-coding RNA (lncRNA) that has been found to promote chemoresistance in breast cancer (BC) by stabilizing GLUT1 mRNA [PMC9187470]. It is part of a nine-lncRNA signature that includes AC103740.1, AC069120.1, CASC11, AC016027.1, ST8SIA6-AS1, AL109615.3, H19, MIR17HG, and TSPEAR-AS2 [PMC7344331]. These findings provide evidence of the role of TSPEAR-AS2 in BC chemoresistance and its direct impact on GLUT1 mRNA stability [PMC9187470]. The identification of this nine-lncRNA signature suggests the potential for these lncRNAs to serve as biomarkers for BC chemoresistance [PMC7344331]. Further research is needed to fully understand the mechanisms by which TSPEAR-AS2 and the other lncRNAs in this signature contribute to BC chemoresistance and to explore potential therapeutic targets based on these findings.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAACUUUCCUUAUGGUCAUCUUUGGGUGGAGCCACCACUUCCAGUUCUGAUCUUCUCAUUCUGGUUGAGUACCUGGGCUUGCCAGUGCACCCCCCAGGAACACCGCCUAGUCCAGGGCUCCCACAGGUCUCAGACUGACAGGAGACUGGGUCAUAUGACCAGCACUAGCCAAUGAGCUGUGAGUACACGUGACACAGGGACAAGCUGGGUCAUGUGACUGGCACUAGCCAAUGAGCUGUGAGGACGUGAGCACAGGUCCAGCUAGGCUGGGUCAUAUGACAAGCAUUAGCCAAUGAGCUGUGAGGACACGUGAGUACAGGUCCAGCUAGGCUGGGACAUGUGACUGGCACUGGCCCAUGGGCUGUGAGCACAGGUCAGGUCAGCCCCUUCCUGCUGCUUCCCACCGUGUGUGCUCCUUGUCUGACUUGAUAUGAGAACUAACCCAAUAUGGCAGGAAGCCACUGACAUGUGGGAGCCGUGCAUGGCAGUGGCCAGCGUCCUUGUCCUGCGGGGGCUCUGUGGACAUCACUCGCCUUCAGAACACUGAGCCCUCCUACCUCCUGAUAUCCAGGGCUGCCGAUGGGAAAUCCCAGGCUGCCGCGGCUCCUGUGUGCUUUGAAGUUUUCAGGAUUUUUGUCAAACAUCCGGGGACCCUUAGCUGGAGAGGAUGGCAUGGGUGACACGCAGCUGGCCAGGGUGCGCGACUCUGCUCUCAAGACCCCCUGGAGGCCCGCCCCCUGCCCCCCACCAGCUCAUUCGUUAGAUGAUUGGAAGUGACUGCCUACGUCUUCUUUCAGGAUAAAGCCUCAAGUCCUGCAACUAUUCCUUGUGUGAUAACGUUUCAAAUCCCUUCCUGGUUCUGGCAAAGCUCCUCAAACAUGCUCCAGUGUGCUGGGGCUCUGCAUGUGUGAGCCUGGGGCCAGCAGGGCGCACGUUCAUGUCAGGGCACCAGUAUGAUCCUGAUGACACAUGACUGGUGUGGAGCCCCGGGUGUUUCCACGGGAACUGCUGUCGGCCGGAUUGCUGUGCUCUGCAGCUGUGCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications