Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1480 (LINC01480) URS000075A984_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01480: LINC01480 is a gene that is expressed in TK6 cells and its expression levels increase with the increase of HQ concentration after 24h or 48h [PMC5707042]. The gene is differentially used in the presence of SF3B1WT and SF3B1K700E, with more isoforms containing IR or partial IR in SF3B1WT [PMC7080807]. The study conducted on TK6 cells exposed to different concentrations of HQ showed that the expression levels of LINC01480 increased with higher HQ concentrations [PMC5707042]. Additionally, the study found that LINC01480, along with other genes such as LINC01089 and XBP1, had differentially used isoforms in the presence of SF3B1WT and SF3B1K700E [PMC7080807]. These findings suggest that LINC01480 may play a role in cellular response to HQ exposure and its expression may be influenced by SF3B1 mutations. Further research is needed to fully understand the functional significance of LINC01480 and its potential role in cellular processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGUUAGUGGAAUUAACAUAUGCCCCACCCCAAGUGACUUCUAAAGGGCUAACUCACCACAAGGGAGUCAGAGCAGAUCUUGGACUGAGACCUACAGGACACAGCGACUCUUAAAUAGGUGGCUCACCAGGAGAAAGGCAUAGCAGAACCUGGACUGAGACCUACGGGAGACAGGCAGACACACAGGAGGUUGGACGUCGAGAGGAGCACAUCAGUGCAAGAACACAUGGGUGGCUGCCACUUCUCUCCCUUUCCUGAGAGGGAAAAACUCUCGACGCUGAGAGGAAUCCACCAACAGGCACCAGCACUCUGGCAGGCCACCGACCAAUGGAUUGACAUAGAGUUUGGCUGGGGCAGCCAGAGGAGAGCCUGGGCCGCUGAAUAACCCGACUUCAGGGGAAAACUAUUCUCCCUUUUGGCUCCCCCAUCUGCUGAGAGCUACUUCCACUCAAUAAAACCUUGCACUCAUUCUCCAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications