v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1936 (LINC01936) URS000075A968_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01936: LINC01936 is a long non-coding RNA (lncRNA) that requires further investigation to determine whether its silencing or overexpression has an impact on the expression of hub genes [PMC7895565]. A risk score formula was used to assess the potential influence of various genes, including LINC01936, on the risk of a particular condition [PMC10082542]. The formula included coefficients for AL590666.2, CH17-340M24.3, MIR31HG, MIR99AHG, LINC01936, and LINC02802 [PMC10082542]. However, specific details regarding the function or role of LINC01936 in relation to hub genes or its potential impact on risk score were not provided in the given context. Therefore, additional studies are necessary to determine the precise role and significance of LINC01936 in gene expression and its potential implications for disease risk [PMC7895565] [PMC10082542].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGACGCCUACCCCGCCUGAGCCAGAGGAAGGGAGGAAAACAAUAGCAAAAACCAGGACCCUUCGGACUUGCCGCUGAAUGGGGAUUUUCGUCGGAUGUUGAGUUUACCUGGAAUGCCCCGGUGUUAUUUUGGGAAGGCAGACAUCCCACGGAAACAAUGAAGUGGAAAAGAAAACAGCUAAAGCAAAAUCUAGAGCCCAGUUUUUGCCAAACCAGCCCCACGUGGGCUGGGCAGGCUCUGGAAGCCCAAGUCAGGCCGAUGAAGAGCGGCUGAGGCCGUGGGGAUCUGGUUUACCAGGAGGGCACAUGGAGGAUGCAAGAAAAGGAAGAGCCGUAUUCAAGUCCCCACUUCAGUGAUGAGGCAGAAAGACCCUGCGCCUGACCACGUGGGAACAGCCUGCAGUGAGCGGUGACGCCGCCUGGCUUGAGCUAAGUGCUGGGCUCCACCAUUCAUUGGCUGAGUGACCUUAGAUGAGAAGAGAAUGAGCCAUGUGUUUCCUGAAACAUCCAGUGGCCUCACCGGAGAAUCUGCAAGAGCCGGUAAACCCAGAAGCUUGGCCGUCCAUUCCUGGAAGCAGACAUUGUGUCUUCGUCCACCAAGCCCCUGGCUCUCAACACUCACUGUGGUGGCAAGAACAUGGCACCUUGACCCUACACAGUUCUUCCAUUUUUCAGAAGCAGGUGAGCACAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications