Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-378b precursor URS000075A8EF_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-378b: Bta-mir-378b is a down-regulated microRNA in multiple intestinal regions of super-shedding (SS) cattle, suggesting its potential role in altering lipid metabolism and immune functions in the intestinal tract [PMC7959717]. It is a member of the miR-378 gene family, which has been implicated in regulating lipogenesis in adipose tissues [PMC7959717]. In the recto-anal junction (RAJ), bta-mir-378b is negatively correlated with PRDM1 and CYLD, genes associated with humoral and cell-mediated immune responses [PMC7959717]. In all intestinal regions, the target transcripts negatively correlated with bta-mir-378b are enriched for immune functions [PMC7959717]. It is worth investigating whether bta-mir-378b directly targets immune-related genes or regulates immune functions through lipid metabolism [PMC7959717]. The down-regulation of bta-mir-378b is associated with an increased expression of PRDM1 and CYLD in RAJ, which may be influenced by translocation of Gram-negative bacteria when the host intestinal mucosal barrier is disrupted or immune defenses are deficient [PMC7959717]. Bta-mir-378b down-regulation suggests its important role in E. coli O157 super-shedding [PMC7959717]. In the distal jejunum, several transcripts are negatively correlated with bta-miR-18a, bta-mir-378b, and bta-miR-2284d between non-super-shedding (NS) and SS cattle. These transcripts are associated with cell-mediated immune responses and hematological system development [PMC7959717]. Bta-mir-378b is down-regulated across all intestinal regions of SS cattle, indicating its potential significance in E. coli O157 super-shedding [PMC7959717].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGACCACCAGGGAAAUCCUGAUUUUGUUUCUUAUUAAGGGGAGGUUCAGUAUAGAGCAAACAGCACUUGACUUGGAGUCAGAAGGCUUAGGUCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications