Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-200a precursor URS000075A884_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR200A: MIR200A is a regulatory gene that is involved in epithelial cell function [PMC7948487]. In a study conducted on A549 cells, the state of H3K36 methylation was examined on the regulatory regions of various epithelial genes, including CDH1, MIR200A, CGN, and the unrelated GAPDH gene [PMC7948487]. In another study involving mesangial cells treated with high glucose and kidneys in diabetic mice models, it was observed that MIR200A was downregulated [PMC5590408]. This downregulation of MIR200A was accompanied by an upregulation of miR-377 and a downregulation of miR-141 [PMC5590408]. These findings suggest that MIR200A may play a role in the regulation of gene expression in epithelial cells and may be involved in diabetic kidney disease [PMC5590408]. Further research is needed to fully understand the mechanisms by which MIR200A influences gene expression and its potential implications for disease pathology.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications