v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 608 (LINC00608) URS000075A844_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00608: LINC00608 is a long non-coding RNA (lncRNA) that has been identified in several studies as a potential candidate for further analysis in spermatogenesis and infertility [PMC7599102]. It is one of the 15 common lncRNAs that have been consistently found across three studies on human germ cells [PMC7599102]. In the context of head and neck squamous cell carcinoma (HNSCC), LINC00608 has also been identified as one of the eight prognosis-related lncRNAs, along with AC010624.1, AC130456.4, LINC01300, MIR99AHG, AC008655.1, AC055758.2, and AC118553.1 [PMC8717422]. Furthermore, LINC00608 has been found to be down-regulated in HNSCC patients [PMC9288825]. In terms of its association with other genes and modules, LINC00608 is part of the blue module along with LINC01300 in HNSCC patients [PMC6759597]. This blue module has been associated with T and N stages and may be involved in protein processing and presentation [PMC6759597]. The potential functions of both LINC00608 and LINC01300 are consistent with the functions associated with the blue module [PMC6759597]. Overall, these findings suggest that LINC00608 may play a role in spermatogenesis as well as HNSCC prognosis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUGGCAUCAUUGCACUGUGACUGUGCAGGUCCCAAACAGUAUGGACAUGAAUGUCCUCAAGCUGCAUGUUAGCAGGGCUUCUAAUUCCAUCUGCAAGUGAUAGUGUGUGGAGCUUAGUUGCACAGAGCGCAUGUUACUGGAGGAGAUAUGGGUCUGUGUCAUCCUGCAUGGGAAUGAUCCUAAAAACAAAGUGAUCAGUGACUGCUCAGGACUGUGGAAAGGUCACUUGGAGCAGUGGGAAAAGGUCUGGCAGAGGAAUAAGAAGAUACAGGUCUUAGAACAAGCCCUGGGACUUCAACCAAGUCAUUUAACAUCUGGGGCCUUCGUUUAUUUAUCCUCCCAGCAGAUAAAGCAAUACCUGCCCUGUCUUCCUAACCUUGGAGGGGUCAAAAAAGUGAUGGGUGUGAAAGCAUUUUGUAAACUGUAGUGCAAGCAUACGGCAGGGGAGUGAACCAUACUUUCACUAGCGACUUGAAUGAGGUGAUAAAGAAAAGGCUCAGAACUUCAGAAAAUGCAAGAGGGGCUUGACCCUGGAUUGGCAGAGGAAAGCAAUGGUGGGAUCGAUACCUUGGAGAGCCAAGGACCAAGGGGUUAAGGGUCCAUGAGGACAGGCCUGGAUCAUCAGGAAGCUGAGUGUGGAUUCCAAGAGUCUCAAGGUUAGAGAAGUCGCCUAGUCCACCUCCCCUCUCUGCUUCUCACAGAAGGGUCUGCUGAACACUCUGGUGACAGAGAACUCACCCAACAUGUUCCAUGGCAGAGGCUUUUCAUUAGAUCAAGGUGACAUCUGUUUUACUGGAGCUUCCAACCACGUGUCCCAAUACUGCCCUUAGUCACAGGCAUCCAGGUCCUCUCUCUCAGGACAGCACUUUGAAUAAAUGAGGACAGCUCCCAUCCCCCUUUCUCCCAGUUGACUUUCCAGAAACAUCUCAUAUUGUUGUUGGCUUUCCACCAUUUUUCCUCUUCACUUCCUGGGCCUACUACUACACUGUGUGUCCUCCACUUGGUCUCUUCCUGAAAGCAACACUGUGCACAAUGUUCCUGGGGGCAGACUUAUUAAACCAAGUGGACCACUUCCUUCAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications