Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-376b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-376b precursor URS000075A7C0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR376B: MIR376B is a microRNA that regulates autophagy genes post-transcriptionally [PMC4502651]. In a recent review, more than 16 miRNAs were identified as regulators of autophagy genes, with MIR376B specifically acting on ATG4 and BECN1 [PMC4502651]. Another miRNA, MIR630, was found to act on ATG12 and UVRAG [PMC4502651]. To investigate the response of endogenous MIR376A and MIR376B levels during starvation stress, a kinetic analysis was performed using TaqMan qPCR [PMC3864973]. This analysis aimed to determine whether the levels of MIR376A and MIR376B were similarly increased during starvation stress [PMC3864973]. The study utilized TaqMan qPCR as a method to measure the expression levels of these microRNAs [PMC3864973]. The findings from this study could provide insights into the role of MIR376A and MIR376B in autophagy regulation under starvation conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUCCUUCUUUGGUAUUUAAAACGUGGAUAUUCCUUCUAUGUUUACGUGAUUCCUGGUUAAUCAUAGAGGAAAAUCCAUGUUUUCAGUAUCAAAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Macaca mulatta microRNA mml-mir-376b precursor
  2. Pan troglodytes miRNA
  3. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 376b (ENSPTEG00000002792.1)
  4. Pongo abelii miRNA
2D structure Publications