Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CHL1 antisense RNA 1 (CHL1-AS1) URS000075A688_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CHL1-AS1: CHL1-AS1 is a long non-coding RNA (lncRNA) that has been investigated for its role in regulating embryonic stem cell (ESC) activity. One study explored the impact of CHL1-AS1 on ESC activity by examining its regulation of the miR-610/MDM2 axis [PMC8367089]. The study identified CHL1-AS1 as an exosomal lncRNA that promotes embryonic mesenchyme (EM) formation and elucidated its downstream mechanism [PMC8367089]. However, the study also acknowledged certain limitations [PMC8367089].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCGUAGUGGCAUGAUCUCAACUCACUGUAACCUCCACCUCCCGGGUUCAAGAUAUUUUUCUGCCUCAGCCUCCCAAGUAGCAGGGAUUACAGAUGUUCAAAGAUGGGGACAAACAAAUAUUUUGUUAGAAACCUGAUGUGAGAACCUGCAUACCUGCUGGUGGUGUUUCAUGAUGGUCUGACGGCUGGCUAGGCUGACUUCUCCCUACUUCGUUCACGGCUAUGACCCUGAACUGGUAUCUCACAAAUGGAGCCAAAGGUGGAAGUGAGAAGCAGGCUGGGAUAUGGACACGACAGAAGAAACAAAAAUGCUCCUUAUUAAUACCGAAGAUCCUUUCCAUUUUGUGUUUUCUUGAAGAUUCUCUGAGCAAUAUUAAAAUCAAAAUAUCAGUGAAGCCCAAGAAACUAUUAACAGCUCCCAGGACUGUGCCCUGAAGUGAGAAGGAAUAAUACAAAGCUGUUUAUGACUCAAAAAGAGGAUCAAAAACCCUCCUCAUUCUGUCAUGCCUCAGUCAUUAUAAAGUUAUGAGUUUGUGAAAUCUUUAGCUCAAAAACUUGAUUACUGUUACCAUUACCUUGAGUUAGCUUUGGAAAUAAAAUAUAGUUACAGAAAUAUGGUGUAGUAUGGUUAAUAGGUAAUUUUUAAAUAUUGACAGCCAUCUGUCACUACAGACACCUGGCUGCCUCUUAAAAUAGGAUGAAGCUGUGCACAUAUCAUGGGCAUACCCUGUAGUUCUUGCAAUAAUCUUUUAGAUGAAACCCAUUCUAGGAAUUUUGAAAAACGGUUCAAAGAACUUUAUCUGGUACUCCAACUUAAAUGGUAUUAUUCCAUUUGGGCAAAUGAAGACAGACUGAACCCAUGUGACAAUUCAUGCAAAGUAACAGUGAAAUAAAAAUACUUCUAAUAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications