Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1264 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1264 precursor URS000075A661_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1264: MIR1264 is a microRNA that is downregulated in response to treatment with UA-Exos, as shown by RT-qPCR analysis [PMC7974330]. It has been identified as a direct target of circRNA-0006896, which contains a putative binding site for MIR1264 in its 3'-UTR [PMC7974330]. Co-transfection of wild-type circRNA-0006896 with MIR1264 mimics leads to a significant reduction in fluorescence intensity, indicating the specific function of circRNA-0006896 as a sponge for MIR1264 [PMC7974330]. The upregulation of circRNA-0006896 in UA-Exos upregulates the expression levels of 122 mRNA molecules by reducing the expression of MIR1264 [PMC7974330]. Additionally, MIR1264 has been identified as a direct target of DNMT1, which can bind to the 3'-UTR of DNMT1 transcript to inhibit its expression [PMC7974330]. The upregulation of circRNA_0006896 in HUVECs is accompanied by downregulated expression of MIR1264 and upregulated expression of DNMT1 mRNA [PMC9953235]. The sponging effect of hsa_circ_0060927 on MIR1264 leads to an increase in DNMT1 transcripts and subsequent hypermethylation of SOCS3 gene, which may contribute to uterine leiomyoma pathology [PMC7171336]. Overall, these findings highlight the regulatory role and potential implications of MIR1264 and its interactions with circRNAs and target genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUCCUCAAUAAGUAUUUGUUGAAAGAAUAAAUAAACCAACAAGUCUUAUUUGAGCACCUGUUAUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications