Homo sapiens (human) microRNA hsa-mir-502 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-502 precursor URS000075A647_9606

86 nucleotides
7 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
Found in 2 other species
209 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR502: MIR502 is a microRNA that has been studied for its impact on the cell cycle in PaTuT cells using flow cytometry analysis [PMC7002776]. The expression of MIR502 has been found to be strong in internodes, roots, and leaves, while it is barely detected in stems and spikes [PMC2394755].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCUCCCCCUCUCUAAUCCUUGCUAUCUGGGUGCUAGUGCUGGCUCAAUGCAAUGCACCUGGGCAAGGAUUCAGAGAGGGGGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.