Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-2284d precursor URS000075A5EA_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-2284d: Bta-mir-2284d is a bovine-specific miRNA that has been identified in several bovine miRNA studies, but its function is still limited [PMC7959717]. In the distal jejunum, the DE gene F3 (also called TF) has been reported to be involved in recruiting leukocytes in the intestine of mice, while the PTGS2 gene (also called COX2) has been suggested to promote humoral immune responses [PMC7959717]. In the duodenum, two target transcripts negatively correlated with bta-mir-2284d, MYC and NLK, were associated with lymphoid tissue structure and development [PMC7959717]. The negatively correlated target transcripts of bta-mir-2284d in distal jejunum were enriched for hematological system development and function [PMC7959717]. Bta-mir-2284d is down-regulated in multiple intestinal regions of super-shedding cattle (SS), including the distal jejunum and recto-anal junction (RAJ), suggesting its potential role in altering lipid metabolism and immune functions [PMC7959717]. Bta-miR-378b is down-regulated in all regions of SS, while bta-miR-2284j is down-regulated in multiple regions including duodenum, distal jejunum, cecum, spiral colon, and RAJ [PMC7959717]. Bta-miR-99a-5p is up-regulated in the proximal and distal jejunum of SS cattle [PMC7959717]. The down-regulation of bta-mir-2284d was observed not only in the small intestine but also in the large intestine of SS cattle [PMC7959717].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUUGACCAAAAAGUUCGUUAGGGUUUUUCUUCAAGCUCUUACGGGAAAACUCGAACAAACCUUUUGUCCAACCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Bos indicus x Bos taurus miRNA (ENSBIXG00000018492.1)
Publications