Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-138 precursor (hsa-mir-138-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-138 precursor (hsa-mir-138-2) URS000075A54D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR138-2: MIR138-2 is a mouse microRNA that is post-transcriptionally regulated and its expression is dependent on the presence or absence of a certain inhibitor of Dicer in tissues like kidney and liver [PMC2647296]. H19, another microRNA, can sequester hsa-miR-107, leading to the release of NF1 expression in NSCLC tumor tissues [PMC7279016]. Despite having proximal NKX2-5 binding sites, MIR138-2 was not dysregulated [PMC6828809]. In a meta-analysis study, MIR138-2 was found to be significantly associated with CAG length in the meta-analysis of Series 1 6 and 10-month data [PMC5764268]. MIR138-1 and MIR138-2 are two distinct genes that encode miR-138 [PMC7376782]. The duplication of the MIR138-2 locus has been identified as one of the copy number variations (CNVs) associated with miR-138 expression [PMC8005705]. miR-137 is expressed from a single locus on Chromosome 3, while miR-138 has two distinct genomic loci (Mir138-1 and MIR138-2) on Chromosomes 8 and 9 in mice [PMC6836737]. In addition to its role in gene regulation during early embryonic development, miR290 has also been associated with maintaining pluripotent cell state [PMC4430308]. Furthermore, MIR138-2 has been implicated in cancer processes such as tumor suppression [PMC9763387].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

2D structure Publications