v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) non-protein coding HTT-AS:2 URS000075A54B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HTT-AS: HTT-AS is an antisense long non-coding RNA (lncRNA) that overlaps with the repeated expansion in the huntingtin (HTT) gene locus. It has been observed to be reduced in the frontal cortex of individuals with Huntington's disease (HD) [PMC7218086]. HTT-AS acts as a transcriptional repressor of HTT gene expression, suggesting a potential protective role in HD [PMC7218086]. It has been shown that overexpression of HTT-AS reduces HTT mRNA levels, while knocking down the lncRNA upregulates HTT transcripts [PMC8327212]. The expression of HTT-AS is highest in neuronal stem cells and has been implicated in neuronal differentiation [PMC6614138]. In esophageal squamous cell carcinoma, a 6-lncRNA signature including HTT-AS impacted prognosis [PMC7884852]. A high-throughput screening identified compounds that decreased HTT promoter activity and increased HTT-AS promoter activity, suggesting potential therapeutic targets for HD [PMC7969751]. The relationship between HTT and HTT-AS is similar, as overexpression of the latter decreases endogenous levels of the former [PMC7969751]. Alterations in known lncRNAs including HTT-AS have been reported in HD patients' brains and have contributed to increased mHTT toxicity observed in HD [PMC7881634]. The co-location of the genes GRK4 and HTT-AS with the huntingtin gene has been identified through chromatin interaction analysis [PMC4872072]. Additionally, upregulation of UCHL1-AS1, BDNF-AS, and HAR1 lncRNAs have been found in Huntington's disease patients' brains [PMC9652419].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAAGGCCGCUGACAGCGCAGCGCCCCACCCGGGCGAAGGCGCGGGGCUCAACGGAGAGGGGACGGGGCGUGGUGAGACUGUAAUGGGCAAUGAACAUGAACUAUUCAGGGGAAGAUUGUUAAAUGAAAGAAUCUCACUGGGCGGGGAGCUAAGCAUGACACCUGGCCACCUGCCUGUGCCUGUCCUGCCGAGAAGAGAGAAGAGGCCUUGAAAGCAGCCAGAGGGGGUGCACACCAGCCUGGGCAGGGGGCAGUAAGCGGGAGCAGCCCCGACCCGAGACCAGCAGCCCCUCUCUUCACCUCCAAGCCGGAGCGUGGCCUCAUCCCUCCCAGGUGACUCUCUUCCCAGAAAUGGUGCUGUCUCAAGAAGCCCCCUCUCUCCAAGCAUCUGCCAGGCCGUUUGAGCUGCCAGGAGUCUUUGUCCUGCCCCACCAGCUCUGUCUCAUCUAGAUGGGGCCUUCUGUCCAGUGCUACUGAACAGAAUGUUCUGCAUGCCUGGCCAGUGCAGAGACCUCCUUGCACCCCUGCUCCAAGGCUGGCUCUGCCACUGACAGAUAGACUGACAUUUGCACUGUUCUGAGCCCCUGGGGGUGCAGUAUGCAGAGCUAGGCCAUCUCUGUCGUCCUACAAGAACCAGGCAGCCCUGAGCAAGGCUUUUAACAUGCAAGGUGUACUCCACUAGUCUUAAGAUAUCUUGAGCCACUGUCUUGCUGCUCCCAACUCCCAAGCCACGCUGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications