Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4319 precursor URS000075A53A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4319: Hsa-mir-4319 is a microRNA that has been studied in various contexts. It has been used in reverse transcription and qRT-PCR experiments, along with hsa-miR-125a-5p, to analyze gene expression [PMC7848293]. In the context of diabetic nephropathy (DN), hsa-mir-4319 is one of the miRNAs that may serve as a diagnostic biomarker for disease progression [PMC9661593]. It has also been predicted to be a microRNA of CD34 and found to be differentially expressed in CD patients [PMC9626979] [PMC8911444]. In the context of triple-negative breast cancer, hsa-mir-4319 has been shown to suppress malignancy by regulating self-renewal and tumorigenesis of stem cells [PMC7296691]. Additionally, hsa-mir-4319 has been found to be expressed at higher levels in MMVP specimens compared to FED samples [PMC4881574]. In the context of acute myocardial infarction (AMI), hsa-mir-4319 is one of the miRNAs that have shown differential expression between AMI patients and normal controls [PMC6388335]. Furthermore, hsa-mir-4319 has been predicted as one of the miRNAs targeting TSEN54 and associated with down-regulated genes [PMC10120902] [PMC9478394]. Overall, these studies highlight the potential roles and significance of hsa-mir-4319 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGCUUGAGUCCCUGAGCAAAGCCACUGGGAAUGCUCCCUGAGGACGUUAUAUGAGUGCUCAGCUCAUGGGGCUAUGAUGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications