Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548p precursor URS000075A50B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR548P: MIR548P is a microRNA that has been found to significantly decrease lipoprotein production and lipid synthesis in hepatocytes. It achieves this by lowering the activity of 3-hydroxy 3-methylglutarylCoA reductase and long-chain acylCoA synthetase ACSL471, which are involved in cholesterol and fatty acid synthesis. However, MIR548P does not affect fatty acid oxidation [PMC7123062]. MIR548P interacts with the 3′-untranslated region of the APOB mRNA, leading to its post-transcriptional degradation and reducing ApoB synthesis and secretion from hepatocytes [PMC7123062]. It has been found that MIR548P reduces ApoB secretion and lipid synthesis through its effects on HMGCoAR and long-chain fatty acylCoA synthase ACSL4 [PMC7123062]. In the context of esophageal squamous cell carcinoma (ESCC), high expression of MIR548P, along with TRAV39, has been associated with a poor prognosis due to the promotion of antitumor immunity [PMC9509226]. Additionally, MIR548P expression was found to be negatively associated with activated mast cells but positively associated with activated T cell CD4 memory cells [PMC9509226]. The expression levels of MIR548P were also found to be correlated with the immune microenvironment in ESCC patients [PMC9509226]. Furthermore, low expression levels of MIR548P were associated with a lower 5-year overall survival rate in ESCC patients [PMC9509226]. However, there was no evidence supporting a positive link between the expression of MIR548P and clinicopathological characteristics in ESCC patients [PMC9509226]. Overall, TRAV39 and MIR548P expressions may serve as predictors for clinical outcomes in ESCC patients by reflecting the status of the tumor microenvironment [PMC9509226].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUAGGUUGGUAUAAAAUUAAUUGCAGUUUUUGUCAUUACUUUCAAUAGCAAAAACUGCAGUUACUUUUGCACCAAUGUAAUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications