v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-137 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-137 precursor URS000075A4FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR137: MIR137 is a gene that has been studied in relation to various diseases, including non-small-cell lung cancer [PMC4626561]. In a study, it was found that the methylation of MIR137 gene was correlated with the progression of non-small-cell lung cancer [PMC4626561]. Additionally, in another study, it was observed that the maximum peak outward potassium amplitude of VU0240551-treated MIR137 cKO neurons was adjusted to a similar level as wild-type neurons [PMC7237267]. These findings suggest that MIR137 may play a role in regulating potassium channels and neuronal activity. Further research is needed to fully understand the mechanisms and implications of MIR137 in disease progression and neuronal function.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCUCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCAGCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000006410.1)
  2. Bos taurus microRNA bta-mir-137 precursor
  3. Capra hircus chi-mir-137 (ENSCHIG00000001488.1)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 137 (ENSCCAG00000008925.1)
  5. Cercocebus atys miRNA (ENSCATG00000000822.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 137 (ENSCSAG00000021688.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000017015.1)
  8. Gorilla gorilla gorilla microRNA 137 (ENSGGOG00000039706.1)
  9. Loxodonta africana (African savanna elephant) microRNA 137 (ENSLAFG00000024092.1)
  10. Macaca mulatta microRNA mml-mir-137 precursor
  11. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000007060.1)
  12. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000020143.1)
  13. Microcebus murinus (gray mouse lemur) microRNA 137 (ENSMICG00000031189.2)
  14. Mustela putorius furo (Domestic ferret) microRNA 137 (ENSMPUG00000020390.1)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 137 (ENSNLEG00000022049.2)
  16. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017506.2)
  17. Ovis aries miRNA (ENSOARG00000023853.1)
  18. Pan paniscus (bonobo) microRNA 137 (ENSPPAG00000020126.1)
  19. Panthera pardus microRNA 137 (ENSPPRG00000013615.1)
  20. Panthera tigris altaica microRNA 137 (ENSPTIG00000003233.1)
  21. Pan troglodytes ptr-mir-137 (ENSPTRG00000027612.2)
  22. Pongo abelii miRNA
  23. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-137 precursor
  24. Pteropus vampyrus (large flying fox) microRNA 137 (ENSPVAG00000024671.1)
  25. Rhinopithecus bieti miRNA (ENSRBIG00000014820.1)
  26. Rhinopithecus roxellana microRNA 137 (ENSRROG00000009555.1)
  27. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000001244.1)
  28. Sorex araneus microRNA 137 (ENSSARG00000015094.1)
  29. Tursiops truncatus (bottlenosed dolphin) microRNA 137 (ENSTTRG00000024022.1)
 2D structure Publications