Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3180 precursor (hsa-mir-3180-2) URS000075A4D6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3180-2: MIR3180-2 is a long non-coding RNA (lncRNA) that is highly co-expressed with known Alzheimer's disease (AD)-related genes, such as S100B, AGT, and NTS [PMC7047416]. It has been found that MIR3180-2 and MIR3180-3 target protein-coding genes (PCGs) involved in the neuroprotective role of THOP1 in AD and blood vessel remodeling [PMC7047416]. Additionally, MIR3180-2 and MIR3180-3 share co-expressed PCGs with known AD-related PCGs, including VTI1A, CUX1, S100B, AGT, NTS, and IRAK4 [PMC7047416]. These findings suggest that MIR3180-2 may play a role in AD pathogenesis. Furthermore, MIR3180-2 is one of the top downregulated lncRNAs in AD [PMC7388310]. Co-expression network analysis has shown that MIR3180-2 is frequently co-expressed with relevant AD risk protein-coding genes [PMC8774680]. It's worth noting that disruptions in mir3180-1, MIR3180-2, and mir3180-3 have been observed along with their target genes CD44 and FAM115A in an individual from Tibet [PMC3938728]. These findings suggest that MIR31802 may have potential as a biomarker for AD.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACGGGCGGAGCUUCCAGACGCUCCGCCCCACGUCGCAUGCGCCCCGGGAAAGCGUGGGGCGGAGCUUCCGGAGGCCCCGCCCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications