v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MAP3K14 antisense RNA 1 (MAP3K14-AS1) URS000075A4CB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MAP3K14-AS1: MAP3K14-AS1 is a long non-coding RNA (lncRNA) that has been studied in the context of metastatic colorectal cancer (CRC) and bladder cancer (BLCA). In metastatic CRC, the methylation dynamics of a panel of genes, including MAP3K14-AS1, were found to be significantly associated with treatment response and progression-free survival in patients [PMC7876389]. MAP3K14-AS1 methylation was also observed to be higher in tumor tissues compared to normal colorectal tissues [PMC9194958]. In BLCA, MAP3K14-AS1 was identified as a prognostic marker [PMC10090514]. Additionally, MAP3K14-AS1 expression was found to be associated with drug sensitivity in various cancer cell lines [PMC9194958]. The lncRNA was also implicated as a protective effector in BLCA and a prevalent methylated locus in colorectal cancer [PMC9908994]. Furthermore, differential methylation of MAP3K14-AS1 was observed in the hippocampus of epilepsy patients [PMC9582525]. These findings suggest that MAP3K14-AS1 may have potential as a therapeutic target or biomarker for monitoring tumor burden and treatment response.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUAGGGCUGGAUCAGGCGGAAGCCGGGGCCCGGGGCUGGGCUUCGUGUCCUGCGUUCCGGGAGCGCCAACCCCUCCAGGGAGAGGCUGUCGAUGCUGAGGCACGAGAGAAUUUGCUCCUGCUCCUCCAGAGAAAAUGGCUGGGACAGGCUGUUGAGGAAUAAUUCUGCAGGGAAAAGUGGAAGAUGGCUGUGAAAGACUGGGAGGAGGCUGGCUGUGUUUUCAGGGGUUCUUCCUGCACAGUCGGUAGAAGCUGAGCUGCUGGGGAAGGGGCUGGAAGAAAGCCCACACCGCAGGUAUCAGUAGCAAAUUCAAAAACUACAGAAUCAGCUCCAGAGGACUUUGUUAACAAGAAAGAGAAGAUUGAAAACAGCCCUGGGGCUACACCAACUCAAGAGCUCCCAGGCAAAGUGGCAUCCUGGACCCACCAUCUCUCCUACCCCAUCCUCAGUCGGUACUUCCCCAGGCACCGUUUGUUCUGGCAUGGGGCUAGUUCAGCCCUGGGACCACCCUCAUCCUUAUAACUACCAGCUGUCUUUGGUGAGGUGCAAGAUCUCUCUGGUUUUCUUUAUUUCAUUUUCAUUCCUAUAAUCACAGCCUUUUUUGUGCCCAUCCCUCAGGUGACAUUCUAUUAUGUUUGAUGUGUCAUUUUUGAUUUGGUUGUGUCCUUGCAAAAUGUGCGUUGUUUUAUUUAUCAAUUUAUUUUUAUUUUUAUUUUUUUAAAGAGAUGAGGUCUCAUCAUGUUGCCCAGGCUGGACUCCAACUCCUGGGCUCAAGCGAUCCUUCCACCUCAAUCUUCUGAGUGGCUGGGACUACAGAUGUGCGCCACCAUACCUGGCUAUUGAUCAAUUUUUAGUUUACCAAACAGGCAUUAUGUUCUGGGUCCCAUUCUGUGUCGGGUUCUCUUUUCACUCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications