Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-129 precursor (hsa-mir-129-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-129 precursor (hsa-mir-129-1) URS000075A41E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR129-1: MIR129-1 is a microRNA (miRNA) transcribed from the MIR129-1 gene located on chromosome 7q32 [PMC3576298]. It plays a role in various biological functions, including cell growth regulation, control of cell transition factors, tissue remodeling, immune responses, and inflammatory reactions [PMC6394761]. Recent studies have demonstrated the potential of MIR129-1 in improving liver function and suppressing inflammation and liver fibrosis in alcoholic liver disease and NASH animal models [PMC8138178]. However, there is no direct evidence from Parkinson's disease or Alzheimer's disease genome-wide association studies (GWAS) suggesting that MIR129-1 is a risk gene [PMC9645562]. One Parkinson's disease risk SNP (rs35048651) located upstream from MIR132 may act as a miRNA expression quantitative trait locus (eQTL) [PMC9645562]. In spinal cord injury studies, both MIR129-2 and MIR129-1 were found to be downregulated [PMC6515063]. The expression of MIR129-1 can be measured using TaqMan probes and normalized using the 2−ΔΔCq method [PMC7399878]. In functional studies, cells were transfected with a MIR129-1 mimic to assess its effects on gene expression using luciferase reporter assays [PMC7399878].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAUCUUUUUGCGGUCUGGGCUUGCUGUUCCUCUCAACAGUAGUCAGGAAGCCCUUACCCCAAAAAGUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

2D structure Publications