Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4287 precursor URS000075A29B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4287: Hsa-mir-4287 is a down-regulated miRNA that has been identified in several studies. In a combined analysis of GSE46823 and GSE83292 datasets, hsa-mir-4287 was found to be down-regulated, along with hsa-miR-1323, hsa-miR-711, and hsa-miR-650 [PMC9812810]. Another study listed hsa-mir-4287 as one of the miRNAs that linked several genes [PMC9480065]. In placenta tissues supporting larger twins of sIUGR, hsa-mir-4287 was found to be down-regulated [PMC5865797]. Furthermore, in a study comparing girls and boys, the expression of hsa-mir-4287 was inversely correlated with the expression of DDX3Y and CDK16 in girls [PMC7993149]. Specifically, DDX3Y was down-regulated in girls while CDK16 was upregulated. Hsa-mir-4287 had the highest opposite deregulation compared to DDX3Y in girls compared with boys [PMC7993149]. Overall, these studies suggest that hsa-mir-4287 is involved in various biological processes and may play a role in different conditions. However, further research is needed to fully understand its functions and mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUUCUUUUUCUCCCUUGAGGGCACUUUUCAGUUCCUGAGAUCAAUGUGGUCCCUACUGGGGAGACCAUAGGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications