Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-381 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-381 precursor URS000075A1A8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR381: MIR381 is a miRNA that has been studied in various contexts. In mice, the Adar K999N mutation resulted in lower levels of editing on the 5-HTR2c A, B, and D and MIR381 editing sites compared to the Adar D1113H mutation [PMC9714073]. In mouse brain endothelial cell line bEnd.3, MIR381 was found to be induced by HHcy [PMC6651274]. In gastric cancer cells, MIR381 was found to have a coupling rate with USP15 [PMC4761210]. MIR381 has also been implicated in mantle cell lymphoma and RTT-mouse models [PMC4761210] [PMC8595945]. Differential expression of MIR381 has been observed in PANC-1 cells and A549/CDDP cells [PMC3849454] [PMC7211148]. However, no miRNA response elements (MREs) for MIR381 were found in the guinea pig Abcb1 isoform 1's 3'UTR [PMC4213008]. The miR655 cluster contains several miRNAs including MIR381 that have available expression data [PMC7465874] [PMC10148110]. In prostate cancer cells, MIR381 is associated with RELN and the PI3K-AKT-MTOR axis and downregulates AR expression to suppress proliferation and progression of cancer cells [PMC8939209]. Additionally, pathways related to cancer were downregulated by MIR381 in rat models of renal ischemia reperfusion injury [PMC8484575]. Finally, editing of NEIL1 and MIR381 promoted the growth of A459 lung cancer cells[ PMC8997934].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCAAGCUCUCUGUGAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

2D structure Publications