Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-330 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-330 precursor URS000075A0E5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR330: MIR330 is a microRNA that has been studied in various contexts. It has been found to be negatively associated with certain ALM components and HLA regulatory factors, such as TAP1, TAP2, CIITA, NLRC5, IRF1, and IRF8 [PMC8393554]. In the context of pancreatic diseases, MIR330 has shown differential expression between chronic pancreatitis patients and pancreatic ductal adenocarcinoma (PDAC) patients [PMC9599289]. It is upregulated in PDAC compared to immortalized pancreatic duct models [PMC9599289]. MIR330 is also associated with alterations in PDAC patients and may be a potential marker for PDAC detection [PMC9599289]. In the context of S. aureus infection, MIR330 expression increases rapidly and contributes to the loss of barrier integrity through down-regulation of ADAM19 and VE-Cadherin [PMC6165832]. The downregulation of MIR330 may also sustain epithelial-mesenchymal transition (EMT) through dysregulation of the RKIP network [PMC9600137]. Additionally, MIR330 has been observed in breast cancer cell lines and is associated with the regulation of target genes in luminal-A subtypes [PMC8261273]. It may also play a role in liver cancer development for chronic hepatitis B patients [PMC9946971]. Furthermore, MIR330 has been implicated in post-myocardial infarction heart failure (HF) and may be a candidate biomarker for HF progression after myocardial infarction [PMC8687817]. It has also shown potential therapeutic effects in acute coronary syndrome by suppressing plaque formation through the WNT signaling pathway [PMC8687817] and stable carotid plaques by targeting Talin-1 in symptomatic carotid stenosis patients [PMC8687817]. Additionally, MIR330 has been shown to inhibit oxidative stress damage in Alzheimer's disease mice and alleviate mitochondrial dysfunction [PMC7249309].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

2D structure Publications