v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4519 precursor URS000075A0A9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4519: MIR4519 is a microRNA that is mapped to a gene encoding noncoding RNAs (ncRNAs) [PMC5545731]. It is involved in tumorigenicity by interacting with its direct target N-ethylmaleimide-sensitive factor (NSF) and associated receptor SNARE [PMC6712160]. The expression of MIR4519 is associated with high risk, as high expression of MIR600HG and low expression of MIR4519, POLD3, and MTA1 were found to be correlated with high risk [PMC6712160]. The Kaplan-Meier plots in Figure 3 show the association between the expression of MIR600HG, MIR4519, POLD3, and MTA1 with survival [PMC6712160]. Additionally, the on-treatment differentially expressed genes (DEGs) include MAGEA1, MAGEA2, KLF10, and MIR4519 [PMC7673759]. References: - [PMC5545731]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5545731/ - [PMC6712160]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6712160/ - [PMC7673759]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7673759/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AACCUCAGCAGUGCGCAGGGCUGCACUGUCUCCGUCUGCGGCCUGCAGUAAGCGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan paniscus (bonobo) microRNA 4519 (ENSPPAG00000014209.1)
  2. Pan troglodytes microRNA 4519 (ENSPTRG00000038653.2)
 Publications