v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 920 (LINC00920) URS000075A08F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00920: LINC00920, also known as LINRIS, is a highly expressed long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases. It has been identified as a prognostic factor in several studies [PMC6886219]. LINC00920 is present in two subsets and is overexpressed in ERG-positive patients, suggesting its potential as a predictive factor for hormone therapy response [PMC7926489]. In prostate cancer, LINC00920 is upregulated by the oncogenic transcription factor ERG and promotes cancer cell proliferation and migration by downregulating FOXO expression [PMC9563963]. Additionally, LINC00920 has been found to block the ubiquitination of IGF2BP2 and maintain the MYC-mediated glycolysis process in colorectal cancer [PMC9883401]. It is also part of a predictive signature for risk stratification in prostate cancer patients [PMC9524195]. Co-expression relationships have been observed between LINC00920 and several genes involved in various biological processes [PMC9524195]. Overall, these findings highlight the importance of LINC00920 as a potential biomarker and therapeutic target for different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGAAGUGAAUCUUCACAGGGAAGGAAGCAACAAAACUCUGCCUUUGGCUUUUGCUGGCUGAGCAGGGAAAGGCCUAUAGACACAGGGCAUUGGGCAGGAGCUAGAACAGCCCUCCCUAGAGCACUACAUAAAGCAGCCAAUAUUUUGCAAAGCAUAGGGAAGAGUGAAAGUCAUCCGGGGCAUUUGCAGACACAGCACUAAGAACUUGGUGACAACAGCCCUGAAGCAAAACAGCAGCAUGUACUGGGCAGGGCUUGGGAGAUAAGACAGGACAUCUGAAGCUAAACAUGGAUCCCCUCUGAAAGCUACAAUCAAAGUGUCAUCCACAAAAUCUUAUCUCAAGCCUUGACUAGAGAAGGACCCACUUCCAAGACCACAGAGUUGAAUGAAUUCAGUCCUUGCAGCCCGUUGAACUGAGGGCCUCCCCAACAUGCUCACCUGCUUCAUCAAAGCCUGCGAGAGAGAGAGUCCACUAGCAAGAGGACAUUGCAGUCUUAUCUAAUGCAAUCACUGAAGUGACAUCCUGUCACCUUGGUCACCUUUUCUAUUCUAUUCAUUAUAAAUGAGUCCCAAGUCCUGCCACACUCAAGUGGAGGGGAUUACACAGGGCUGGAGUACCAGCGGUGGGGAUAAUUUGGGGUCAUCUUAGAGUUCUUCCAUCACACGGGAAUUCUCAGCUCACCAAAUCUGGGAUUCCGCAUCUGGCCAUUCCUUAAGCUGAAGGCCUGGCAUAUUUUUGAGUGUCCAUUUGGAUCAGCUAAUAAACCCAGGGUUUGUCUACUGGCUGGAGGAGUAAGAACUAUAAGGCUAAUUGAAAUGAAUCUACUUAAAAUAGUGACCUGAUUUUUCUAAUAAUUACUGGAAGGUAAGGGUUGAUUGAGACUUUAAAAUAAAACCAAAAAUUAUUCUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications