Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-200b-5p URS000075A08C_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-200b: Gga-mir-200b is a microRNA that is significantly differentially expressed in various studies. In one study, it was found to be up-regulated 2.2-fold in the fat line [PMC4326283]. Another study used Taqman probes to detect gga-mir-200b, indicating its importance in quantification [PMC7477046]. Integrative miRNA target prediction and network analysis revealed that gga-mir-200b targets the RECK gene, which is related to skeletal muscle development in chickens [PMC7999090]. Additionally, gga-mir-200b was predicted to target both SREBP-1c and HMGCR genes [PMC3436634]. It belongs to the miRNA gene family of miR-8 and is located in the same miRNA cluster as gga-miR-200a and gga-miR-429 [PMC3436634]. In a study on leptin-treated chickens, gga-mir-200b was found to be significantly up-regulated in the liver [PMC3436634]. Overall, these findings highlight the importance of gga-mir-200b in various biological processes and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUACUGGGCAGCAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications