Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1233 precursor (hsa-mir-1233-1, hsa-mir-1233-2) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1233 precursor (hsa-mir-1233-1, hsa-mir-1233-2) URS0000759F8D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1233: Hsa-mir-1233 is a microRNA family that has been studied in various contexts. It has been found that the conserved mature microRNA sequences of hsa-mir-1233 are missing from the cDNA sequences deposited in the database [PMC3602292]. The hsa-mir-1233 family is part of a larger group of microRNAs, some of which have nearly identical mature sequences, while others have different features [PMC3602292]. Experimental validation using labeled probes confirmed the presence of hsa-mir-1233 and another microRNA family called hsa-mir-622 [PMC3602292]. The hsa-mir-1233 family is expanded in the human genome compared to other primates [PMC3602292]. It has been associated with golgi autoantigen and golgin subfamily a, 6 pseudogenes, which are expressed in fetal brain and embryonic stem cells [PMC3602292]. Hsa-mir-1233 has also been found to be involved in various signaling pathways, including TLR, TGF-β, and Wnt signaling pathways [PMC5314349]. Additionally, hsa-mir-1233 has been identified as one of the miRNAs associated with parotid gland neoplasms and can be used as a predictive marker for their presence [PMC4636154]. Hsa-mir-1233 expression levels have also been found to be higher in whole saliva samples from patients with parotid gland neoplasms compared to healthy controls [PMC4636154]. Furthermore, it has been observed that hsa-mir-1233 is expressed in serum sEV preparations [PMC7265139], and it may interact with other miRNAs to play biological roles [PMC7354774].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGUGGGAGGCCAGGGCACGGCAGGGGGAGCUGCAGGGCUAUGGGAGGGGCCCCAGCGUCUGAGCCCUGUCCUCCCGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications