v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ATP1A1 antisense RNA 1 (ATP1A1-AS1) URS0000759F49_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ATP1A1-AS1: ATP1A1-AS1 is an antisense long non-coding RNA (lncRNA) that is located on the reverse strand of human chromosome 1 [PMC6073804]. Inhibition of DNA methylation has been shown to upregulate the expression of ATP1A1-AS1, but it does not affect the expression of the ATP1A1 gene [PMC6073804]. ATP1A1-AS1 has been found to be negatively correlated with the infiltration of gamma delta T cells and eosinophils in allograft-infiltrating immune cells [PMC7739051]. However, its regulatory effect on Na/K-ATPase α 1 expression in human kidney cells is moderate [PMC6073804]. The expression levels of ATP1A1-ASl, along with other lncRNAs (lncR-MELTF-ASl and IL10RB-DT), have been detected in carcinoma and adjacent tissues of ccRCC patients with different T-stages, as well as in renal tubular epithelial cells and various RCC cell lines [PMC7222502]. Overexpression of FOXA 11 does not significantly regulate the expression of ATP 11 A 11 - ASI [PMC6073804]. The high expression levels of both ATP 11 A 11 - ASI and its sense transcript, ATPIAI, indicate favorable clinical outcomes and high survival probability [PMC9530462]. In addition, ATPIAI-ASl has been identified as one of seven glycolysis-related lncRNAs with prognostic significance in cancer patients [PMC8403747]. Furthermore, overexpression of ATPIAI-ASI has been shown to affect cell proliferation [PMC6073804].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCACCUGAGCGGCGCAUCCUCAGGGCCUGGGCCUGGCCUCCUUGCCUGUGAGAUGGCACUGUGACGGUGCCCACCUCGUGGGGUGUGUGAGGGCCGAGUGAAAUCGUGCAUUUGCGGAAAUGCCCAUGACCUUCAUCGCAGCAGCGUAUGUGCGUUGGUCUUCUCCAGGGAUGCCGAAAGUAGACAUACAGGGAGUCGCAGUACGGAUACCACCAGUGCCAGCCUGACCUCACAAGAGACGUCUUGUGUGACUGGCCCUGCCGUCACAGCUGGGCCAGUAAAGUACCUUCCAGGAGGCUCCAGUUGCUACCUGACUCACAACCUUCUAAUCCCAUGAUCUUUUAGUUCUAGUUUCCUUAUCUUGGUCUGAGCAAAUGGCUCAUUUUAAAGAUGACUUGCAGACAAAUGUAGAGAUCAUCCCAGGGGAAAGUGCCCCAAGAAAGGAGAGUCCAAGACCACCUGCCCCUCCCAGUUCUGCGGCUGGAGUGGGUGGGUGCAGCAACCACAGCCCCAGUGUACAGGAGUCACCACUGUCUCCUCCCGCAUUGGCCCAGCUUGGAAGUGCACAGCAACCAAGCAUGAGGACUGAGUUAAGCUUUUCGGAGAAAAAAGACACUAUGAUCAUCUGGCAGAUCACGAUCACUGUUUGGUGCCAGAGGUAAGGAGUUUGCUUGUUGUGUUUGCUUGGAGGCGACAGUUGGCAAUGACAGCCUGGGAGAAGCACCGGCAGUUAACAGCACUCUGCACCACUCAUGGCUGAGACUGAGGGGAGCCUUUUACAGCAGCUCUGAAAGCAGGAGGUGUUCUCAGACUUGACCCUGAAGUAAACACAUCUCUUUCACCUUUUUCUUAAGUGCUUGCUGGCACAUAACCACUUGCUGAAAUUGUGUCAUUGAUGCUAAAUUAGGAACACAUUAUAUGGAAGGAAGGGAACCACUUCUCAGCACACAUGCCCAGGCAGACUGUGUGGGAUAGAUUUCUGCUUCUCAGAUAAGCCCUGGGCUAGAGACACUUGAGAUGUGGUGGUGAUCUCUGGAGGGAAAGCAGGAAGGCUUCAGGUCUCUUUUAGACUGAAAGAGAAGGGCCUCAUCUGCAGUUUAGUAUACUCUGAGGGUCUGGAAAUCCUUUAGGCGAGGUGCUCUUCCAUCAAAAAGCCAGAUGCUAAGGCAGCAGGUGGAGUUACAGCCCUAUCACCCCAGGCAGCAGCCAGAAAAAAUGGGUCAGGUAAACUCACCUACUCCAACUAAAAGAGCACGGGCAGAAUGCUUCCUCUUAGCCAGUGGUUUCCAAACUUGAAUGUAAAUCAAAAUCACCUGAGGGCUUAUUAAGCCACAUUGCUGAUGCAUUUCUGACUCAGUGGGUCUGGGCCCGCCUUCCUAGCAAGCAACCAGGUGAUGCUGAUAAACUGCUGGUCAGGGACUCAUGUUGAAAACCACAGCUCCAGAUCACAUAGACAUCUGUACCAAAGAAGCGACGAGGGCACAGACAAAUUCCAUUAUAAUAGCCAUCUUUAUUUGUAAAAAUCCAGAUAUAAAAUGUAUUCUUUCAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications