Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-301a precursor URS0000759EFA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR301A: MIR301A is a microRNA that is regulated by glycine through NMDA receptor-dependent signaling [PMC4880874]. The expression of MIR301A was tested in FXR1-depleted cells to determine if it is regulated by FXR1 [PMC6986764]. In addition to miR128, miR152, miR130a, and MIR301A, other miRNAs such as miR-130b and miR-26b-5p were found to be downregulated in the serum of high-risk women compared to low-risk women and predicted to regulate CSF-1 [PMC6411608]. In some tetrapods and teleosts, MIR301A is located in the first intron of ska2 but is missing in seadragons [PMC9245644]. The role of MIR301A in cancer cell proliferation, migration, invasion, and apoptosis regulation is still under debate [PMC6912041]. IL-6 was found to be overexpressed in serum and CRC tissues and correlated with CRC tumor stage, invasion depth, lymph node metastasis, CEA levels, relapse risk, overall survival (OS), and disease-free survival (DFS) [PMC8040557][PMC6411608][PMC9245644][PMC6912041][PMC6411608][PMC9245644][PMID: 10.1002/ijc.33410]. IL-1β was shown to promote colon cancer cell proliferation through the NF-κB pathway by increasing the expression of miR-181a and MIR301A [PMID: 10.1002/ijc.33410] [PMID: 10.1002/ijc.33410] . IL-6 production induced by IL-1β from neutrophils in the intestinal mucosa promoted tumor initiation and progression [PMC8040557][PMC6411608][PMC9245644][PMC6912041]. PNPT1-mediated degradation of MIR301A was found to be blocked by FXR1, and in the absence of FXR1, PNPT1 was recruited to degrade MIR301A-3p [PMC6986764].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000001952.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000026839.3)
  3. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000020071.2)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 301a (ENSCCAG00000003639.1)
  5. Cercocebus atys miRNA (ENSCATG00000022109.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 301a (ENSCSAG00000024734.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000007941.1)
  8. Dasypus novemcinctus (nine-banded armadillo) microRNA 301a (ENSDNOG00000031572.1)
  9. Echinops telfairi (small Madagascar hedgehog) microRNA 301a (ENSETEG00000022308.1)
  10. Equus asinus asinus miRNA (ENSEASG00005002531.1)
  11. Equus asinus (ass) microRNA 301a (ENSEASG00005002531.2)
  12. Equus caballus (horse) microRNA eca-mir-301a precursor
  13. Gorilla gorilla gorilla microRNA 301a (ENSGGOG00000033263.2)
  14. Macaca fascicularis microRNA 301a (ENSMFAG00000014582.2)
  15. Macaca mulatta microRNA mml-mir-301a precursor
  16. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004218.1)
  17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000016384.1)
  18. Microcebus murinus (gray mouse lemur) microRNA 301a (ENSMICG00000019239.3)
  19. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 301a (ENSNLEG00000025448.2)
  20. Oryctolagus cuniculus (rabbit) microRNA 301a (ENSOCUG00000019161.1)
  21. Pan paniscus (bonobo) microRNA 301a (ENSPPAG00000011803.1)
  22. Pan troglodytes ptr-mir-301a (ENSPTRG00000027584.2)
  23. Papio anubis miRNA (ENSPANG00000014709.3)
  24. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000038653.1)
  25. Pongo abelii microRNA 301a (ENSPPYG00000021192.2)
  26. Prolemur simus miRNA (ENSPSMG00000008211.1)
  27. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000011090.1)
  28. Pteropus vampyrus (large flying fox) microRNA 301a (ENSPVAG00000026275.1)
  29. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 301a (ENSRFEG00010011502.1)
  30. Rhinopithecus bieti miRNA (ENSRBIG00000010974.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000004996.1)
  32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000036408.1)
  33. Theropithecus gelada (gelada) microRNA 301a (ENSTGEG00000021634.1)
  34. Tupaia belangeri microRNA 301a (ENSTBEG00000018011.1)
Publications