Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U5F small nuclear 1 (RNU5F-1) secondary structure diagram

Homo sapiens (human) RNA, U5F small nuclear 1 (RNU5F-1) URS0000759ECB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU5F-1: RNU5F-1 is a small nuclear RNA (snRNA) that is downregulated in the AC group [PMC6616969]. It is also one of the five small nuclear RNAs that are modulated in response to certain stimuli [PMC4694891]. Additionally, RNU5F-1 is located in the intron of RNU5F-1 and IARS2, and it has been reported to respond to p53 activation [PMC6120784]. Furthermore, RNU5F-1 has been identified as a sentinel variant or close proxy for lung function-associated loci [PMC4686825]. It is located in a DNase hypersensitivity site and may play a role in lung function [PMC4686825]. Interestingly, Pol II termination is not inevitable at T-runs on RNU5F-1, as shown by extended reads beyond some T-stretches [PMC7610016]. Overall, RNU5F-1 is a downregulated snRNA that may have functional implications in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCUCUGGUUUCUCUUCAUAACGAAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAAAAACAACUAUGAGUUUAUGGUUAAAUUUUUUGAAGUCUUGCCUAGGCAAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications