Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1264 URS0000759E8E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1264: Hsa-mir-1264 is a microRNA that has been found to be upregulated in various conditions, including chronic limb ischemia (CLI) [PMC6179988]. In a study, it was observed that hsa-mir-1264 was upregulated in the CLI group compared to the control group [PMC6179988]. Another study found that hsa-mir-1264, along with hsa-mir-4497 and hsa-mir-4485, showed significant upregulation and shared homologies with Zika virus (ZIKV) [PMC8049460]. Additionally, hsa-mir-1264 was found to be significantly upregulated in other conditions such as CHIKV infection [PMC7690852]. In the context of genetic variations, it was predicted that rs4695253 could lead to target loss for hsa-mir-1264 [PMC8365884]. Furthermore, in a miRNA-mRNA interaction network analysis, hsa-mir-1264 was identified as one of the microRNAs with a high degree of mRNA interaction [PMC9967650]. Interestingly, IGFBP5 is one of the genes targeted by hsa-mir-1264 among 144 other miRNAs [PMC7854084]. In summary, hsa-mir-1264 is a microRNA that has been observed to be upregulated in various conditions such as CLI and CHIKV infection. It has also been found to have homologies with Zika virus. Furthermore, genetic variations can affect the target interactions of this microRNA. In terms of mRNA interactions, it shows a high degree of interaction with several target genes. One such gene is IGFBP5.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGUCUUAUUUGAGCACCUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1264
  2. Equus caballus (horse) eca-miR-1264
  3. Pan troglodytes ptr-miR-1264
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-1264
Publications