Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1186 (LINC01186) URS0000759D9D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01186: LINC01186 is a long non-coding RNA (lncRNA) that has been found to play a role in suppressing cell proliferation and invasion [PMC6176258]. Specifically, in lung cancer, LINC01186 acts as a tumor suppressor and inhibits migration and invasion through the process of Epithelial-Mesenchymal Transition (EMT) [PMC6176258]. EMT is a cellular process that is involved in the progression of cancer, where epithelial cells lose their characteristics and acquire mesenchymal properties, leading to increased cell migration and invasion [PMC6176258]. The findings suggest that LINC01186 has potential as a therapeutic target for lung cancer due to its ability to suppress tumor growth and inhibit the invasive properties of cancer cells [PMC6176258]. Further research is needed to fully understand the mechanisms by which LINC01186 exerts its tumor-suppressive effects in lung cancer. In conclusion, LINC01186 is an lncRNA that acts as a tumor suppressor in lung cancer by inhibiting cell proliferation, migration, and invasion through EMT [PMC6176258]. These findings highlight the potential importance of LINC01186 as a therapeutic target for lung cancer treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCUAACAGAAACCCAGCCCUGCCCACUGGGUGAAACUGCAAGUCGAGAGCGUGGGAAACCAGCAAGUUGAGAGAGGAUCCAGAAGUAACCCCUUCUAAAACGGGAAAGAUGCCUUCCGAAAGCACUUGGCCCUAAAGAGAAAACACUAGGAGGAUGGGAACCAGGGACAGAGAAGCUACUUGCUCUGCAGCUGUUUGGGCCAGUAUGUUCCCUAAUCUUGAUGGCCAUCCUGGGCUUAUUUUCCUGAGAGUCUCUAAGUGACUCACUGCAUCACGUAAAACUAAGAAAAAGGAUGUCCUGAAUUUUCCUGCUUAGAGAGCUUGUUUUUCUUUCCUGUUGCAUCAAAGGGGUCUGUUAAACUUUCUAAAAGUACUAAUCUGACCUGAUAUCUGAAGUAACAGAUAGGAAUUUGGGCUCUUUAAAUGGAGCCCUUCCCCCAUACCUGCAUCUCAUUGAAGAGGCUGAACUUCAAAACAAAAUCAUGUUGGAGAAUUAAGUCUCGUUCCCAGAUUUAAUUUCUUAUUUUUAUAUUGUUGCAUAAGAAAUCUACUCUAUAAGGCAUCUAUUUUCAAAUUUGGAAAAUCUUAUUUUAAGUUCAUUUAUUUAAAGACCAACAAACAAAAACACCAAAUUCACUAGCCCAGGUCUUUAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications