Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-921 URS0000759CD8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-921: Hsa-mir-921 is a microRNA that has been predicted to interact with has_circ_0007843 and is found to be overexpressed specifically in the BRCAX-C group [PMC3833208] [PMC8324362]. Functional studies have shown that hsa-mir-921 significantly decreases the luciferase activity of CHO cells after transfection with the CBR1 3′-UTR construct carrying the major rs9024 G allele, as well as a decreased level of CBR1 protein and CBR1 activity in lymphoblastoid cells that contain the homozygous major rs9024 G allele [PMC3486798]. Hsa-mir-921 selectively binds only to the CBR1 3′-UTR construct carrying the G allele, and its co-transfection with pCBR1-1096A failed to produce a significant decrease in luciferase activity [PMC3486798]. Hsa-mir-921 accelerates decay of CBR1 mRNA compared to miRNA mimic negative control, suggesting its role in regulating CBR1 expression [PMC3486798]. Hsa-mir-921 is co-expressed with CBR1 in human liver and heart tissue, indicating its potential role in regulating CBR1 expression in these tissues [PMC3486798]. The inhibitory effects of hsa-mir-921 on CBR1 mRNA expression are interfered by the 3′-UTR SNP rs9024 [PMC9606405].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAGUGAGGGACAGAACCAGGAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications