Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-499a precursor URS0000759CC2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR499A: In our study, we failed to observe an association of the polymorphism in the rs3746444 polymorphism of MIR499A and the miR-499a expression [1]. MIR499A expression was also examined in Ad-HBV or Ad-GFP infected HepG2 cells [2]. In addition, we explored the target gene of MIR499A to disclose the underlying mechanism of MIR499A functions in HCC [2]. References: 1. Zhang, Y., Zhang, Y., Li, X., Zhang, X., Liang, H., Liang, W., ... & Wang, Y. (2021). The association between polymorphisms in microRNA genes and hepatocellular carcinoma risk: a meta-analysis. BMC cancer, 21(1), 1-12. [PMC8514969] 2. Wang, Y., Tohme, S., & Gao, Z. (2014). MicroRNA: a new therapeutic target for human hepatocellular carcinoma. Gastroenterology research and practice 2014. [PMC4207808]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCUGUCCCCUGUGCCUUGGGCGGGCGGCUGUUAAGACUUGCAGUGAUGUUUAACUCCUCUCCACGUGAACAUCACAGCAAGUCUGUGCUGCUUCCCGUCCCUACGCUGCCUGGGCAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications