Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-539 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-539 precursor URS0000759CA5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR539: MIR539 is a microRNA that is part of the miR655 miRNA cluster, which contains a total of 20 miRNAs. Nine of these miRNAs, including MIR539, have available expression data [PMC7465874]. MIR539 has been found to be either upregulated or downregulated in colorectal cancer cases with subsequent relapse, as part of a 5-miRNA signature [PMC5110606]. In non-small cell lung cancer cells, targeting DCLK1 with MIR539 has been shown to increase sensitivity to cisplatin [PMC7904745]. Additionally, MIR539 has been found to be involved in mitochondrial fission and cardiac apoptosis in cardiomyocytes [PMC7123062]. It has also been identified as a sponge for cardiac apoptosis-related lncRNA and regulates PHB2 expression [PMC7123062]. In rat models of myocardial infarction, increased expression of MIR539 inhibits the expression of MEK and leads to impaired proliferation and apoptosis of cardiomyocytes [PMC7527411]. Furthermore, MIR539 is located in the DLK1-DIO3 imprinting region that contains a microRNA cluster involved in leukemia pathogenesis [PMC4633733]. It has also been suggested that MIR539 may contribute to erythropoiesis based on progressive hypomethylation observed during the differentiation process from hematopoietic stem cells to erythroid progenitors [PMC4633733]. Additionally, down-regulation of MIR539 promotes MMP8 expression and activates TGF-β1 signaling in hepatocellular carcinoma progression [PMC8712501].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACUUGAGGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGACAAUUUCUUUUUGAGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

2D structure Publications