Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Danio rerio (zebrafish) microRNA dre-mir-20b precursor secondary structure diagram

Danio rerio (zebrafish) microRNA dre-mir-20b precursor URS0000759C9C_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-20b: Dre-mir-20b is a type of microRNA that has been studied in relation to embryo development and retinal morphology [PMC6834413]. In a study, it was found that in the 4 uM dre-mir-20b group, the embryo mortality rate was significantly higher and the survival rate was significantly reduced compared to the NC group and wild type group (Table 1) [PMC6834413]. Additionally, the mRNA expressions of FGF2 and GRB2 were significantly lower in the dre-mir-20b group compared to the NC group and wild-type group (Figure 9B) [PMC6834413]. Abnormal retinal morphology was observed in the dre-mir-20b group, characterized by sparse and irregular photoreceptor cells [PMC6834413]. Furthermore, there were more overall morphological abnormalities, particularly a significant reduction in eye volume in the 4 uM dre-mir-20b group (Figure 9A) [PMC6834413]. Immunofluorescence tests showed that FGF2 and GRB2 were expressed in the photoreceptor cell layer, but their expression levels were decreased in the dre-mir-20b group compared to the NC group and wild type group (Figure 10B, 10C) [PMC6834413]. The study used 4 uM dre-mir-20b mimics and corresponding negative control (NC) injected at single cell stage [PMC6834413]. These findings suggest that dre-mir-20b plays a role in embryo development, retinal morphology, and gene expression regulation [PMC6834413].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGUUUGUCCUGGCAGUUCCAAAGUGCUCACAGUGCAGGUAGUGCCAGUGGAUCUACUGCAAUGUCUGCACUUCAAGUAUUGCCGGACGCCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications