Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-411 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-411 precursor URS0000759C2D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR411: MIR411 is a microRNA that has been shown to target Drp1 and is upregulated in DHBE cells compared to NHBE cells [PMC9626984]. Differential miRNA cargo within sEVs containing MIR411 may induce senescence in healthy epithelial cells and could be a potential target for therapeutics in idiopathic pulmonary fibrosis [PMC9930250]. In the context of Alzheimer's disease (AD), MIR411 is downregulated in the cortex of AD patients [PMC7564652]. MIR411 has been previously studied and reported in the brain tissue of AD patients [PMC7564652]. In fibroblasts, MIR411 has higher expression compared to its expression in D492 cells [PMC7308478]. Additionally, MIR411 is downregulated in AF+AVBvsCTL and AFvsCTL analyses [PMC8376273]. MIR411 is part of the miR655 cluster, which includes other miRNAs such as miR134, miR154, and miR655 [PMC10148110]. In colorectal cancer (CRC), MIR411 is one of five microRNAs that can distinguish lymph node metastasis [PMC9614158]. Furthermore, MIR411 is expressed in BMSC-derived exosomes and can modulate the NF-κB pathway to inhibit pro-inflammatory cytokine release [PMC7897935]. Along the Dlk1-Dio3 imprinted domain, which includes Mir136 and Mir127 along Rtl1as, Mir370 along Rian, Mir154 along Mirg, and other miRNAs such as MIR411 are transcribed from the maternal chromosome [PMC3919614]. Finally, a risk-prediction model for lymph node metastasis includes MIR411 as one of five associated microRNAs [PMC8593512].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCAAAUCCAUCCCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

2D structure Publications