v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1010 (LINC01010) URS0000759A88_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01010: LINC01010 is a long non-coding RNA (lncRNA) that has been shown to interact with vimentin, inhibiting the extension of the vimentin network and interfering with the assembly of vimentin filaments [PMC8620790]. It has been reported that both LINC01010 and TUSC8 act as suppressors in the invasion of multiple cancer cells through different pathways [PMC8620790]. Additionally, LINC01010 is involved in multiple signatures that predict tumor prognosis [PMC8419766]. AL161431.1, another lncRNA, has been found to facilitate tumor cell proliferation and migration in endometrial carcinoma [PMC8419766]. Furthermore, a lncRNA signature containing AL161431.1 has been identified as a prognosis predictor in lung squamous cell carcinoma (LUSC) [PMC8419766]. However, many of the lncRNAs involved in this classifier have not been reported in other lung cancer studies [PMC8419766]. In hepatocellular carcinoma (HCC), it has been observed that HBx down-regulates the transcription of LINC01010 to attenuate its function, potentially contributing to HCC progression [PMC8620790]. Overall, LINC01010 is an lncRNA that interacts with vimentin and plays a role in inhibiting invasion of cancer cells and predicting tumor prognosis. It is also affected by HBx down-regulation in HCC. However, further research is needed to fully understand its function and potential therapeutic implications. Word count: 199 words

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUCAUACUGCUGUUGAUGAUGUGAAUUUUGGAAAUAUUCUCCCCUAUUGGGUCUUUCUCCAUGACAGAUGAUGUCCUUUGGCUUCGGUUUUUUGCCUAAGAACUGUAAGUGGUGCUUGCUAGCCCUACUAAGAAUCCUGCCAUUGUUGCAAAUUUCAGAAAAAAGGCUGGAGUGCAGUGGUGCACACGCCUCACACUGUGACACAGCGGGAGAGCCCAGAGCGACAGCUGUUGGAAUGACUGCACUCUUCCUGCUCAAGUCUGACCUUUCCAAGGUAGGAUUUGAUUACAACUAGCAAUAUGGAAUUACAAGCAGGGAGAGGUGCCGAGACCACAAGACAUCAGGAGACUAAAAUAGCAAGGUGGUGAGGCAAUCUGCCUUUUAUUCCCCUUUCAAGCUAUGAGAAGUAGGCAAAUGAUGCGGCUGAACAAUGCCUCCUUGACUUCAGGAUAUAAAAACUACUUUCAUGAGCUUCAAGUCAGGCCUUUGUCCUAUGUCUGGAGACUUCUUGGAAGCUGGAGCACACAAAUAGCUACAGCAAACUUGAGGAAUGGGCAUGAAUAGACUGGCUUCGGGGAACCUGCCAGCUUGGCCGUGUGGCCAAGGUAAUAGGCAAGCCAAGGCAGAGCUAGAGCUCAGAGCUGGAGGGGAAAUUAAAGCAGCAAAUGUAGAAACAUUAAGCCUGAAGAGGCGACGACGUUGAAUUCUAAAAUGCAGGCCAAAGCUCAGACUGCAAGCUGUCUGGCUGCUCCGGGUGUGCCCAGAAGUCAAAGUCCAGCAGGGGCAAAGGUGGAGGUGUGGUCCUGCACGUGGGGUGUUGGGGGGAUGUGGAAGAGGAGGUGCUUUAAGAUCCAGAGAUUCCAGCUGCCCUGGUGCACCCUUGGAAGAAUAAAAGGCUAGGAACUGGACAAGUCAGGCUCGAGUCCAAGCUGCCUGAGGAAUCGGGGAAAGAAUGGAGCUCAGAGUGGGAGGUCAGGGCAGUAUUUAAAAAUCCAGGAUAGCAGCAAAGCUGGCGGUGGCCCCUGACUCUGGUAAGGGCAGCCUGCAGCACCAUGCCAAGGGGGGCCUGACUGAUCAUGCCCUGCAUUUGCAAACAAGGAUUAGUAGGGUAUGAGUAGGAUUCUGCUGGUGCCUGGGAAGGCAGUGCCAUCUACAACUUUACAAAGUUUUAACAAAGGCCUGAAGGACACAACCUUCCCCAAAGUCCUGACGUCGCUGUUUGCUGGCAACAAAUAGAGUCAAAAGAAGAGAGGCACAGAAUGUGCCAGGGGUGUGCUGCGUACAGCCCCGAUGACCACAAGGCCUUCUUGGGUCAAGUUCUGCCAUCUCUGGUUAAGAUGGGCUCACCCUCUAGGACCCUGAUUGAGUCCUCGGACCACCAAGAGUGCCCCACCAAGAGCCUCCCUCUUCUGGUGACUCGUGCCUGCUUCCCGUGGAGAGCUCCAGAAGGGAGGAAACUGUGAGGAGGUGGAGAACGUGGCAGGGAUCCUAACUUUCUUACUGAAGGAAGUUCUUCACAAGUACCCAUCUGCCUUCAGGGAAGAAAACAUAACUCAUUUUGGUCUUUCAAAUUCAGUUCUCAAAACCAAAUCCUGUUGUCAGCAAUCUGUGUCCCAACGCCUUCUUCAGCAACAGCAUUUUCCCUGUGGAAUUAGUUUCCAAUGUUCUUUCUUAAAUAAACCACUGAAGAUUAAAAGGAAUCCAGAUACCCACCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications