Gallus gallus (chicken) microRNA gga-mir-122 precursor (gga-mir-122-1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-122 precursor (gga-mir-122-1) URS0000759A85_9031

77 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 7 other species
8 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAUCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Chrysolophus pictus microRNA 122 (ENSCPIG00010007178.1)
Coturnix japonica (Japanese quail) microRNA 122 (ENSCJPG00005004886.1)
Dromaius novaehollandiae (emu) microRNA 122 (ENSDNVG00000009886.1)
Numida meleagris microRNA 122 (ENSNMEG00000015155.1)
Pavo cristatus (Indian peafowl) microRNA 122 (ENSPSTG00000001712.1)
Phasianus colchicus microRNA 122 (ENSPCLG00000015685.1)
Struthio camelus australis (African ostrich) microRNA 122 (ENSSCUG00000001421.1)

Publications