Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-409 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-409 precursor URS0000759A5D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR409: MIR409 is a microRNA that has been studied in various contexts. In gastrointestinal stromal tumors (GISTs), the expression of MIR409 was found to be deregulated, with higher expression in intestinal tumors compared to gastric tumors [PMC5796982]. MIR409 was also found to be one of the representative miRNAs from the DLK1-DIO3 locus, specifically from cluster B [PMC7308478]. In double-infected transplanted livers, the downregulation of MIR409 was associated with the early onset of fibrosis [PMC8869900]. MIR409 has been predicted to target Sox6 and has been studied in the context of inducing induced cardiomyocytes (iCMs) from cardiac fibroblasts [PMC4488424] [PMC6679082]. Additionally, MIR409 has been identified as one of the miRNAs in the miR655 cluster and has available expression data [PMC7465874]. It has also been associated with various traits such as weight loss and lean mass [PMC5659802]. In CAP (community-acquired pneumonia), plasma levels of MIR409 were reduced compared to healthy controls [PMC8358855]. Furthermore, MIR409 was identified as a hub gene in SJS/TEN (Stevens-Johnson syndrome/toxic epidermal necrolysis) and has been reported in previous studies as differentially expressed miRNA [PMC9027774] [PMC4393113]. The association between copy number variations at 14q32.2-q32.31, including MIR409, and sensitivity to bleomycin in renal cell carcinoma cell lines was observed [PMC9716673]. Finally, predicted targets of MIR409 include CTNND1, CTNNA1, and CTNNB1 which have implications for pancreatic cancer prognosis proteins. [PMC10057657].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUACUCGGGGAGAGGUUACCCGAGCAACUUUGCAUCUGGACGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Ailuropoda melanoleuca microRNA 409 (ENSAMEG00000023251.2)
  2. Canis lupus dingo microRNA 409 (ENSCAFG00020010826.1)
  3. Canis lupus familiaris miRNA (ENSCAFG00000051453.1, ENSCAFG00030003004.1, ENSCAFG00845005334.1)
  4. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000029857.1)
  5. Cercocebus atys miRNA (ENSCATG00000017212.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000016899.1)
  7. Equus asinus asinus miRNA (ENSEASG00005000099.1)
  8. Equus caballus (horse) microRNA eca-mir-409 precursor
  9. Gorilla gorilla gorilla microRNA 409 (ENSGGOG00000031274.2)
  10. Macaca fascicularis microRNA 409 (ENSMFAG00000033571.2)
  11. Macaca mulatta microRNA mml-mir-409 precursor
  12. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004551.1)
  13. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000013187.1)
  14. Mustela putorius furo (Domestic ferret) microRNA 409 (ENSMPUG00000020278.1)
  15. Nannospalax galili miRNA (ENSNGAG00000002347.1)
  16. Neogale vison microRNA 409 (ENSNVIG00000009538.1)
  17. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 409 (ENSNLEG00000021113.2)
  18. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017552.1)
  19. Pan paniscus (bonobo) microRNA 409 (ENSPPAG00000005941.1)
  20. Pan troglodytes ptr-mir-409 (ENSPTRG00000027824.2)
  21. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000002454.1)
  22. Pongo abelii miRNA
  23. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-409 precursor
  24. Prolemur simus miRNA (ENSPSMG00000023354.1)
  25. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000000549.1)
  26. Pteropus vampyrus (large flying fox) microRNA 409 (ENSPVAG00000024875.1)
  27. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 409 (ENSRFEG00010004056.1)
  28. Rhinopithecus bieti miRNA (ENSRBIG00000000920.1)
  29. Rhinopithecus roxellana miRNA (ENSRROG00000014858.1)
  30. Ursus americanus microRNA 409 (ENSUAMG00000020952.1)
  31. Ursus maritimus microRNA 409 (ENSUMAG00000022085.1)
  32. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 409 (ENSUTTG00000000073.1)
  33. Vulpes vulpes microRNA 409 (ENSVVUG00000028609.1)
  34. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015005625.1)
2D structure Publications