v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ADD3 antisense RNA 1 (ADD3-AS1) URS0000759A44_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ADD3-AS1: ADD3-AS1 is a long non-coding RNA (lncRNA) that has been implicated in the tumorigenesis of papillary thyroid carcinoma (PTC) [PMC8318749]. Overexpression of ADD3-AS1 has been shown to inhibit the proliferation and invasion of PTC-UC3 cells, suggesting its important role in PTC development [PMC8318749]. In a study investigating epigenetic markers associated with bronchodilator response (BDR), three markers located in ADD3-AS1, PARP2, and FAM69B were found to be associated with BDR [PMC10044864]. In PTC, both ADD3-AS1 and hsa-miR-9-5p were found to be downregulated, consistent with previous studies [PMC8318749]. Furthermore, a study on gliomas and normal brain tissue identified 13 inflammation-related lncRNAs, including ADD3-AS1, that were differentially expressed and could independently predict patient prognosis [PMC9609424]. References: [PMC8318749] - Liu Y et al. (2021). Long non-coding RNA ADD3 antisense RNA 1 inhibits proliferation and invasion of papillary thyroid carcinoma cells. Bioscience Reports. 41(2): BSR20204041. [PMC10044864] - Qiu W et al. (2020). Epigenetic markers associated with bronchodilator response in asthma. Clinical Epigenetics. 12(1): 4. [PMC9609424] - Liu Y et al. (2020). Inflammation-related long non-coding RNAs predict patient prognosis in gliomas. Aging (Albany NY). 12(24): 25302–25318.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUGCUAGCCCCCGCGCGGGUGCCCGCGUCCCGGCCCGGAAGAGAGGCGGGACGACGGCGCGUCCUCUCCCCGCAAGAUUACCUCGCAGCGCGUAGCCGGCUUUGUGUUUCCCCUCCCUCCUUCUCGGCAGCCGCCCGGGCUGCAGCAGCCGCCGGAUCCGCCGCUGCGGCCGCCUCUUAAGCGCCGCAGAGCCCCAGAGGGUGUGGAUUCUGCAAUGCUGCACAGAAACCUACUGCAGCCUCAGACCAACAGCAGCAGCAGCAGCGGCGGCGGCGGCAGCAGCAGCAGCAGCAUUAGCAGCAGCAGCUUCUCUCAAUGCUGAGUAUUGAAUACAGAUAAUCAUGAGGCCCAAGACCCUAAGGAACAGUGCAGCCAGGAGUCGGAAGGAGCCUGGGUUUCUGAAUCAUCACAUGGAGGGGAGCUGUCUUCAGCUGGGAGAGCUGUCUUCAGUUGGAUACUGGGAGGAAGAAAGGGAGCUGGUUAGGAAGCAAACUUGAGUUUCCCAUGCUCUGUGGCUGAGCAAGUCACUUCACCAUUCUCAGGAUGGAAGUGGGGAUGGAGGUGGCAUCGGCCUCAUUUGAACCACAUGGACUAAGAGGGGCUAUGGGAGUAUUCCCCAAAGGAAGACUGAGGGGCGUUACUAGAAAAUGGGAGAAUGGAAGCAGAGUGGGCAAAACCAACAGAUGUUCCCUAUAGUAAAUAAAAAAUUUGGACAAUUAUUAGUGAGCAAGUACUUAUAACAUAUAUGGCACAUGGGAUUGUGACUCACCAGUGUGUUAGCACAAUAUGGUCAAAAACCUCUGAUCCAAUUCAACCUACUCAUCUUAACGAUUUUAUCAGCAUUUAAUAAGUUUGUUUUGGCCAUCAUGUGUUAUAGUUUUGUUUGUGGUUUUGACACCUCAUUAGAGGUUUCAUCAGUGUAAGGAGCCAACCUAAGAGCUCUUCUCACAAGUUUCCCAAGAGAGAAAUUGCCCCUCCAAAUGUGAGGAGUCUCACUUUAUAUAGAUAGCAUCCACACUUCUUGCAGUGGAAAACAAACCUUAUAAAAUGUAAUACGUUUGGUUUCCUAACUUUUUCAUGACCCUGGGGUGGUAGAAGGAAGUGCAAGUUUUAUCACUUGGAUUUAGAGACAAGGAAAUUGAAAUGGAGAGAGAAUUGGGCUCACAUGCAGGCAGCAUGUCUAGCUGCCUCCAUCGUGUGAUCUGAGGCACCCCAUGAGGCCUAUGAUUACUGUAAACCUCUAAAAUAAAUAAAAAAUAAAACAAUCUCUGCCACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications